Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26690
Trapped Gene
Dap3 (ENSMUSG00000068921)
Vector Insertion
Chr 3: 88729334 - 88730193
Public Clones not available
Private Clones OST103301 (lexicon) OST25631 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000567028 (Chr3:88730194..88730283 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAATCGTGTTGAGCTTGAG Chr3:88730255..88730274 59.6 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000567028 (Chr3:88730194..88730283 -)
Downstram Exon
ENSMUSE00000567027 (Chr3:88729216..88729333 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAATCGTGTTGAGCTTGAG Chr3:88730255..88730274 59.6 50 AGGCTCCAGGGCATTAAATC Chr3:88729288..88729307 60.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000567043 Chr3:88753790..88753873 CGGAGCAGGAGTCCTAGTGT Chr3:88753800..88753819 59.47 60
upstream ENSMUSE00000567041 Chr3:88746697..88746750 CTTTTCTCCAGGGTCCAGAA Chr3:88746698..88746717 59.26 50
upstream ENSMUSE00000567038 Chr3:88740071..88740175 TGAGCGTCCCAGAACTGTTT Chr3:88740094..88740113 60.83 50
upstream ENSMUSE00000567036 Chr3:88737487..88737588 CTGCCTCCTCGGTACATGAT Chr3:88737491..88737510 60.1 55
upstream ENSMUSE00000567034 Chr3:88734834..88734942 GTGAAGACTTTTGGCGAAGC Chr3:88734923..88734942 60 50
upstream ENSMUSE00000567033 Chr3:88734398..88734490 TCAGTCTCTGCCATGCTGTT Chr3:88734444..88734463 59.58 50
upstream ENSMUSE00000567032 Chr3:88733318..88733448 GCGCTTTGATCAACCCTTAG Chr3:88733374..88733393 59.85 50
upstream ENSMUSE00000567031 Chr3:88732369..88732449 GCACTGAGAAAGGCAGTCCT Chr3:88732390..88732409 59.6 55
upstream ENSMUSE00000567030 Chr3:88732131..88732289 CCTAACCCGAGTGAGGAATG Chr3:88732268..88732287 59.54 55
upstream ENSMUSE00000567029 Chr3:88730933..88730992 GAGGAACTCTCCCTTGTCCA Chr3:88730964..88730983 59.23 55
upstream ENSMUSE00000567028 Chr3:88730194..88730283 GCAATCGTGTTGAGCTTGAG Chr3:88730255..88730274 59.6 50

*** Putative Vector Insertion (Chr 3: 88729334 - 88730193) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000567027 Chr3:88729216..88729333 AGGCTCCAGGGCATTAAATC Chr3:88729288..88729307 60.42 50
downstream ENSMUSE00000567026 Chr3:88727558..88727835 CAGGTCAGGGTGTTCAGCTT Chr3:88727628..88727647 60.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000068921