Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26708
Trapped Gene
Rims4 (ENSMUSG00000035226)
Vector Insertion
Chr 2: 163704969 - 163744322
Public Clones not available
Private Clones OST102715 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000327409 (Chr2:163744323..163744419 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCTACTTCCCGTGCATGA Chr2:163744347..163744366 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000327409 (Chr2:163744323..163744419 -)
Downstram Exon
ENSMUSE00000382731 (Chr2:163704830..163704968 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCTACTTCCCGTGCATGA Chr2:163744347..163744366 59.67 50 GCTGTCCTCGATGGACTCAT Chr2:163704834..163704853 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000327409 Chr2:163744323..163744419 CATCTACTTCCCGTGCATGA Chr2:163744347..163744366 59.67 50
upstream ENSMUSE00000680116 Chr2:163744323..163744662 CATCTACTTCCCGTGCATGA Chr2:163744347..163744366 59.67 50

*** Putative Vector Insertion (Chr 2: 163704969 - 163744322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000382731 Chr2:163704830..163704968 GCTGTCCTCGATGGACTCAT Chr2:163704834..163704853 60.23 55
downstream ENSMUSE00000327394 Chr2:163691528..163691640 CACTGAACTGGGCATCTGAA Chr2:163691572..163691591 59.83 50
downstream ENSMUSE00000551385 Chr2:163691189..163691290 No primer for this exon
downstream ENSMUSE00000721634 Chr2:163690602..163690741 TTGTACAACGGGTCCAGTGA Chr2:163690626..163690645 60 50
downstream ENSMUSE00000721918 Chr2:163690602..163690741 TTGTACAACGGGTCCAGTGA Chr2:163690626..163690645 60 50
downstream ENSMUSE00000377807 Chr2:163689617..163689857 CGTAGTTTCCCCACACGATT Chr2:163689814..163689833 59.85 50
downstream ENSMUSE00000680113 Chr2:163689617..163689857 CGTAGTTTCCCCACACGATT Chr2:163689814..163689833 59.85 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAACCCTGCAGAGCAACT Chr2:163741311..163741331 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAACCCTGCAGAGCAACT Chr2:163741311..163741331 60.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035226