Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26711
Trapped Gene
9430015G10Rik (ENSMUSG00000059939)
Vector Insertion
Chr 4: 155488037 - 155488111
Public Clones not available
Private Clones OST102604 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000523654 (Chr4:155487998..155488110 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCGCTGCTAAGTAAAAAG Chr4:155488080..155488099 59.17 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000523654 (Chr4:155487998..155488110 +)
Downstram Exon
ENSMUSE00000666792 (Chr4:155488038..155488110 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCGCTGCTAAGTAAAAAG Chr4:155488080..155488099 59.17 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523655 Chr4:155484089..155484132 No primer for this exon
upstream ENSMUSE00000666793 Chr4:155484108..155484132 No primer for this exon
upstream ENSMUSE00000523654 Chr4:155487998..155488110 GGCCGCTGCTAAGTAAAAAG Chr4:155488080..155488099 59.17 50

*** Putative Vector Insertion (Chr 4: 155488037 - 155488111) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666792 Chr4:155488038..155488110 No primer for this exon
downstream ENSMUSE00000385637 Chr4:155491119..155491212 CCTGTCAGAAGGCCAGTCAG Chr4:155491187..155491206 61 60
downstream ENSMUSE00000710047 Chr4:155491119..155491212 CCTGTCAGAAGGCCAGTCAG Chr4:155491187..155491206 61 60
downstream ENSMUSE00000226680 Chr4:155493273..155493348 ACATCCATGCAACACTCAGG Chr4:155493304..155493323 59.55 50
downstream ENSMUSE00000226670 Chr4:155496042..155496137 CATTCCAGTGCCTGTAGCAA Chr4:155496065..155496084 59.86 50
downstream ENSMUSE00000133857 Chr4:155496460..155496525 AAATGTGGCTGTCCAGGTGT Chr4:155496526..155496545 60.43 50
downstream ENSMUSE00000133853 Chr4:155497644..155497778 GGAGCGCTTGAGGTAGAAGA Chr4:155497744..155497763 59.72 55
downstream ENSMUSE00000133861 Chr4:155498085..155498110 No primer for this exon
downstream ENSMUSE00000133860 Chr4:155498201..155498231 No primer for this exon
downstream ENSMUSE00000462960 Chr4:155499526..155501368 CACAGACCCCACATGACTTG Chr4:155499863..155499882 60 55
downstream ENSMUSE00000666791 Chr4:155499526..155500328 CACAGACCCCACATGACTTG Chr4:155499863..155499882 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATTGGAAATGCCCAGCTT Chr4:155488038..155488058 61.31 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATTGGAAATGCCCAGCTT Chr4:155488038..155488058 61.31 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059939