Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26714
Trapped Gene
Tnni1 (ENSMUSG00000026418)
Vector Insertion
Chr 1: 137701439 - 137701629
Public Clones CMHD-GT_487E1-3 (cmhd)
Private Clones OST101840 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690462 (Chr1:137701424..137701438 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690462 (Chr1:137701424..137701438 +)
Downstram Exon
ENSMUSE00000366440 (Chr1:137701630..137701671 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGTTTACGGGAGGCAGTGA Chr1:137701665..137701684 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690462 Chr1:137701424..137701438 No primer for this exon

*** Putative Vector Insertion (Chr 1: 137701439 - 137701629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366440 Chr1:137701630..137701671 GAGTTTACGGGAGGCAGTGA Chr1:137701665..137701684 60.26 55
downstream ENSMUSE00000158877 Chr1:137702076..137702207 GTGTTCCTGCTCCCAACACT Chr1:137702123..137702142 60.16 55
downstream ENSMUSE00000158882 Chr1:137704098..137704187 GGAGGCATTTGGCTTCAATA Chr1:137704176..137704195 60.04 45
downstream ENSMUSE00000158887 Chr1:137705210..137705386 CCTTGTGCTTAGAGCCCAGT Chr1:137705333..137705352 59.5 55
downstream ENSMUSE00000158885 Chr1:137706203..137706312 GCCAGACATAGCCTCCACAT Chr1:137706259..137706278 60.1 55
downstream ENSMUSE00000412315 Chr1:137707190..137707564 GGCACGAGCAGAAAGATAGG Chr1:137707269..137707288 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr1:137701488..137701508 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCACTACGTGACTGGGAAA Chr1:137701483..137701503 59.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026418