Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26747
Trapped Gene
Wdr34 (ENSMUSG00000039715)
Vector Insertion
Chr 2: 29887493 - 29887592
Public Clones not available
Private Clones OST100061 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286744 (Chr2:29887593..29887750 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAGCCCCTTACCTCACTG Chr2:29887672..29887691 59.86 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286744 (Chr2:29887593..29887750 -)
Downstram Exon
ENSMUSE00000337969 (Chr2:29887159..29887492 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAGCCCCTTACCTCACTG Chr2:29887672..29887691 59.86 60 TGATCCAAGTCCTCCACCTC Chr2:29887257..29887276 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711889 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000714590 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000286799 Chr2:29893695..29893946 ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50
upstream ENSMUSE00000696764 Chr2:29893695..29893946 ATGCCTTCGATGGCTATGAG Chr2:29893722..29893741 60.2 50
upstream ENSMUSE00000286790 Chr2:29890283..29890392 AACTCGACAGGCTCTGTGCT Chr2:29890301..29890320 60.21 55
upstream ENSMUSE00000286778 Chr2:29889326..29889483 GCCATCAGTAGTGGTGGAGGT Chr2:29889382..29889402 61.35 57.14
upstream ENSMUSE00000286767 Chr2:29888794..29888903 TTTGGCGTACAGGTCTGACA Chr2:29888824..29888843 60.3 50
upstream ENSMUSE00000286759 Chr2:29888270..29888437 AGATGGCAAGGTGTTGCTCT Chr2:29888359..29888378 59.87 50
upstream ENSMUSE00000286753 Chr2:29887922..29888154 TTTGACTCCAGCCTTTTCGT Chr2:29888084..29888103 59.85 45
upstream ENSMUSE00000286744 Chr2:29887593..29887750 CTCAGCCCCTTACCTCACTG Chr2:29887672..29887691 59.86 60

*** Putative Vector Insertion (Chr 2: 29887493 - 29887592) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337969 Chr2:29887159..29887492 TGATCCAAGTCCTCCACCTC Chr2:29887257..29887276 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTTCAGGGGAAGGTAGG Chr2:29887586..29887606 61.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGTGAAGATCGTGACTGG Chr2:29887532..29887552 59.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039715