Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26748
Trapped Gene
St8sia1 (ENSMUSG00000030283)
Vector Insertion
Chr 6: 142825278 - 142862543
Public Clones not available
Private Clones OST100054 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294871 (Chr6:142862544..142862688 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAGCCTGTGGTACGATGG Chr6:142862599..142862618 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294871 (Chr6:142862544..142862688 -)
Downstram Exon
ENSMUSE00000197044 (Chr6:142825168..142825277 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAGCCTGTGGTACGATGG Chr6:142862599..142862618 60.13 55 ATCTATTTGACGGCCACAGC Chr6:142825166..142825185 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336487 Chr6:142912056..142912972 GGCGAAGATCCTTGTAGCTG Chr6:142912449..142912468 59.98 55
upstream ENSMUSE00000294871 Chr6:142862544..142862688 AAGAGCCTGTGGTACGATGG Chr6:142862599..142862618 60.13 55

*** Putative Vector Insertion (Chr 6: 142825278 - 142862543) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197044 Chr6:142825168..142825277 ATCTATTTGACGGCCACAGC Chr6:142825166..142825185 60.1 50
downstream ENSMUSE00000197047 Chr6:142816374..142816466 GCGAATTATGCTGGGGTTAG Chr6:142816357..142816376 59.57 50
downstream ENSMUSE00000341920 Chr6:142770061..142777790 CAGACTCTAGGCCATGCACA Chr6:142776174..142776193 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCTGGCAGTTCTTGCTGA Chr6:142832540..142832560 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCAGCTGACTGCTACAGAGA Chr6:142826560..142826582 58.06 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030283