Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2675
Trapped Gene
Aven (ENSMUSG00000003604)
Vector Insertion
Chr 2: 112333379 - 112354606
Public Clones (sanger) AL0526 (sanger) CMHD-GT_516H12-5S (cmhd) IST14747F6 (tigm)
IST12389G1 (tigm) IST10462E2 (tigm) IST12827E5 (tigm) IST12827E5 (tigm)
IST11101D9 (tigm) IST14747F6 (tigm) IST12502G11 (tigm) IST12389G1 (tigm)
IST11843E11 (tigm) IST12394C11 (tigm) IST14749D6 (tigm) IST13505D1 (tigm)
IST10901D5 (tigm) IST12715C7 (tigm) IST12502G11 (tigm)
Private Clones OST427487 (lexicon) OST425789 (lexicon) OST416812 (lexicon) OST406024 (lexicon)
OST352692 (lexicon) OST339292 (lexicon) OST339231 (lexicon) OST338577 (lexicon)
OST282864 (lexicon) OST266611 (lexicon) OST251772 (lexicon) OST249196 (lexicon)
OST232799 (lexicon) OST180042 (lexicon) OST165696 (lexicon) OST117580 (lexicon)
OST81030 (lexicon) OST42515 (lexicon) OST37044 (lexicon) OST30971 (lexicon)
OST13696 (lexicon) OST6671 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362311 (Chr2:112333121..112333378 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362311 (Chr2:112333121..112333378 +)
Downstram Exon
ENSMUSE00000311948 (Chr2:112354607..112354784 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362311 Chr2:112333121..112333378 No primer for this exon

*** Putative Vector Insertion (Chr 2: 112333379 - 112354606) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311948 Chr2:112354607..112354784 No primer for this exon
downstream ENSMUSE00000686189 Chr2:112399911..112399944 No primer for this exon
downstream ENSMUSE00000166341 Chr2:112465312..112465382 No primer for this exon
downstream ENSMUSE00000166338 Chr2:112467906..112468001 No primer for this exon
downstream ENSMUSE00000166339 Chr2:112469897..112470233 No primer for this exon
downstream ENSMUSE00000642572 Chr2:112470936..112471227 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGATGAATAATCGCCTTGC Chr2:112348422..112348442 58.72 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGAACGTGCTTAAGTGTC Chr2:112333360..112333381 59.94 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003604