Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26762
Trapped Gene
AC131691.4 (ENSMUSG00000074911)
Vector Insertion
Chr 16: 91709136 - 91710079
Public Clones not available
Private Clones OST98960 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697826 (Chr16:91709023..91709135 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTTACCGACCACTTCGT Chr16:91709066..91709085 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697826 (Chr16:91709023..91709135 +)
Downstram Exon
ENSMUSE00000697825 (Chr16:91710080..91710143 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTTACCGACCACTTCGT Chr16:91709066..91709085 60.03 55 TGAGGCCATTTTACTTCGTTTT Chr16:91710115..91710136 60 36.36

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697827 Chr16:91689143..91689525 GGCTCGGAAAAGGGATTAAC Chr16:91689226..91689245 59.91 50
upstream ENSMUSE00000697826 Chr16:91709023..91709135 CCACTTACCGACCACTTCGT Chr16:91709066..91709085 60.03 55

*** Putative Vector Insertion (Chr 16: 91709136 - 91710079) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697825 Chr16:91710080..91710143 TGAGGCCATTTTACTTCGTTTT Chr16:91710115..91710136 60 36.36
downstream ENSMUSE00000697823 Chr16:91710395..91710505 AGGATTCCGTCTGAGAGCTG Chr16:91710429..91710448 59.56 55
downstream ENSMUSE00000697821 Chr16:91711993..91712198 TTTGTTTCGGATGGTTGTGA Chr16:91712100..91712119 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGTTACCTTCCTGCCAAC Chr16:91709101..91709121 59.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGTTACCTTCCTGCCAAC Chr16:91709101..91709121 59.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074911