Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26769
Trapped Gene
Slc24a1 (ENSMUSG00000034452)
Vector Insertion
Chr 9: 64783831 - 64785041
Public Clones not available
Private Clones OST98671 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251654 (Chr9:64785042..64785095 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAAAACGAGCAACAGGA Chr9:64785058..64785077 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251654 (Chr9:64785042..64785095 -)
Downstram Exon
ENSMUSE00000251636 (Chr9:64783722..64783830 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAAAACGAGCAACAGGA Chr9:64785058..64785077 60.38 50 GTAGATGGTGTTGCGGATGA Chr9:64783737..64783756 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000532769 Chr9:64799285..64799414 CAAGTTTCCCGAACTTGGAA Chr9:64799308..64799327 60.08 45
upstream ENSMUSE00000394387 Chr9:64795640..64797560 GGTTCTGAACACACCGACCT Chr9:64796704..64796723 60.01 55
upstream ENSMUSE00000251654 Chr9:64785042..64785095 GAGGAAAACGAGCAACAGGA Chr9:64785058..64785077 60.38 50

*** Putative Vector Insertion (Chr 9: 64783831 - 64785041) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251636 Chr9:64783722..64783830 GTAGATGGTGTTGCGGATGA Chr9:64783737..64783756 59.53 50
downstream ENSMUSE00000251624 Chr9:64779974..64780057 GGGAGAGAACTCTGGCTTCC Chr9:64779979..64779998 60.34 60
downstream ENSMUSE00000251609 Chr9:64778987..64779078 TGGATCGTCCTCCTGATCTC Chr9:64778974..64778993 60.16 55
downstream ENSMUSE00000251528 Chr9:64775765..64776520 TTTTTGCCTTCTGCCTCTGT Chr9:64776269..64776288 59.99 45
downstream ENSMUSE00000251506 Chr9:64774970..64775059 ATGATGGATCCCAGGAAGGT Chr9:64774994..64775013 60.54 50
downstream ENSMUSE00000251481 Chr9:64773976..64774142 CGATCACACTGGTGATGAGG Chr9:64774027..64774046 60.11 55
downstream ENSMUSE00000393400 Chr9:64770668..64772477 ACAGCAAGACGATTGCACAG Chr9:64772361..64772380 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000034452