Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26794
Trapped Gene
Ebp (ENSMUSG00000031168)
Vector Insertion
Chr X: 7762960 - 7763769
Public Clones IST10108A11 (tigm)
Private Clones OST97200 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207018 (ChrX:7763770..7763900 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTCCGCTTTGTCCTACAG ChrX:7763786..7763805 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207018 (ChrX:7763770..7763900 -)
Downstram Exon
ENSMUSE00000400606 (ChrX:7762461..7762959 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTCCGCTTTGTCCTACAG ChrX:7763786..7763805 59.87 55 GCTGGAGTCCTTCGTGTAGC ChrX:7762881..7762900 60.02 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000207019 ChrX:7769927..7770006 AGTCGCAAGCCTGTGTTAGG ChrX:7769955..7769974 60.45 55
upstream ENSMUSE00000207021 ChrX:7767205..7767562 ACTTCGCATATCCTGGTTGG ChrX:7767405..7767424 59.96 50
upstream ENSMUSE00000207022 ChrX:7764009..7764045 TCCAAGGGAGATAGCCGATA ChrX:7764015..7764034 59.62 50
upstream ENSMUSE00000207018 ChrX:7763770..7763900 CCTTCCGCTTTGTCCTACAG ChrX:7763786..7763805 59.87 55

*** Putative Vector Insertion (Chr X: 7762960 - 7763769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000400606 ChrX:7762461..7762959 GCTGGAGTCCTTCGTGTAGC ChrX:7762881..7762900 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATCCATCGTGACTGGGAAA ChrX:7763705..7763725 60.32 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 2 AGCACAATGATGCCAGTGTC ChrX:7763915..7763935 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 AGCACAATGATGCCAGTGTC ChrX:7763915..7763935 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031168