Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2680
Trapped Gene
Arfip1 (ENSMUSG00000074513)
Vector Insertion
Chr 3: 84319713 - 84323403
Public Clones AL0508 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638632 (Chr3:84323404..84323625 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTCAAGAACTGTGGACCT Chr3:84323570..84323589 59.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638632 (Chr3:84323404..84323625 -)
Downstram Exon
ENSMUSE00000638630 (Chr3:84319555..84319712 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTCAAGAACTGTGGACCT Chr3:84323570..84323589 59.31 55 TAATGGCCCCAAGAAGAGTC Chr3:84319618..84319637 59.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674131 Chr3:84386336..84386547 GGAGGAGACGAAGGAAAAGC Chr3:84386444..84386463 60.33 55
upstream ENSMUSE00000674130 Chr3:84351856..84351957 GGCTCAAGAATCTCCCAAAA Chr3:84351927..84351946 59.24 45
upstream ENSMUSE00000674129 Chr3:84338509..84338617 CCAAAGAGGGGGTTACTGAA Chr3:84338525..84338544 59.02 50
upstream ENSMUSE00000674128 Chr3:84333092..84333187 CAGGGTGGCAGCTAGTAAGC Chr3:84333128..84333147 60.04 60
upstream ENSMUSE00000674127 Chr3:84331608..84331720 CACACACAAAAGGAGGACCA Chr3:84331689..84331708 59.56 50
upstream ENSMUSE00000638632 Chr3:84323404..84323625 GGCTCAAGAACTGTGGACCT Chr3:84323570..84323589 59.31 55

*** Putative Vector Insertion (Chr 3: 84319713 - 84323403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638630 Chr3:84319555..84319712 TAATGGCCCCAAGAAGAGTC Chr3:84319618..84319637 59.13 50
downstream ENSMUSE00000638629 Chr3:84313730..84313904 GCGGTACGCATCATATTCAA Chr3:84313861..84313880 59.55 45
downstream ENSMUSE00000638628 Chr3:84299985..84301813 GCACTGGATTTTCCGTCCTA Chr3:84300458..84300477 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTGTGGGTGTAAGGGTA Chr3:84323357..84323377 59.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTGTGGGTGTAAGGGTA Chr3:84323357..84323377 59.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074513