Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26806
Trapped Gene
Nudcd2 (ENSMUSG00000020328)
Vector Insertion
Chr 11: 40547657 - 40549519
Public Clones (sanger) D118G10 (ggtc) (ggtc) IST12243G2 (tigm) IST12934G8 (tigm)
IST12857G1BBF1 (tigm) IST12243G2 (tigm) IST13066B2 (tigm) IST12757G8 (tigm)
IST12989G1HMF1 (tigm)
Private Clones OST96332 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350329 (Chr11:40547386..40547656 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350329 (Chr11:40547386..40547656 +)
Downstram Exon
ENSMUSE00000103419 (Chr11:40549520..40549568 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350329 Chr11:40547386..40547656 No primer for this exon

*** Putative Vector Insertion (Chr 11: 40547657 - 40549519) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000103419 Chr11:40549520..40549568 No primer for this exon
downstream ENSMUSE00000103421 Chr11:40549995..40550146 No primer for this exon
downstream ENSMUSE00000103424 Chr11:40552661..40553546 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGTCCCGAGTTCCTTCT Chr11:40547671..40547691 60.77 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGTCCCGAGTTCCTTCT Chr11:40547671..40547691 60.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020328