Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2681
Trapped Gene
Rps6ka2 (ENSMUSG00000023809)
Vector Insertion
Chr 17: 7476006 - 7481811
Public Clones AL0501 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000556248 (Chr17:7475941..7476005 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGTCACCCGTTCTTTGTC Chr17:7475971..7475990 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000556248 (Chr17:7475941..7476005 +)
Downstram Exon
ENSMUSE00000503144 (Chr17:7481812..7481914 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGTCACCCGTTCTTTGTC Chr17:7475971..7475990 60.01 50 TAAACTCGGGGTCAAAGTGG Chr17:7481899..7481918 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447545 Chr17:7374464..7374792 GATGGAGCTGAGCATGAAGA Chr17:7374693..7374712 59.07 50
upstream ENSMUSE00000614339 Chr17:7374521..7374792 GATGGAGCTGAGCATGAAGA Chr17:7374693..7374712 59.07 50
upstream ENSMUSE00000556280 Chr17:7432262..7432378 AGGACAAGGGTCGTATGGAA Chr17:7432357..7432376 59.4 50
upstream ENSMUSE00000658409 Chr17:7432262..7432378 AGGACAAGGGTCGTATGGAA Chr17:7432357..7432376 59.4 50
upstream ENSMUSE00000512907 Chr17:7440395..7440476 CAGCTCTACGCCATGAAGGT Chr17:7440434..7440453 60.42 55
upstream ENSMUSE00000658408 Chr17:7440395..7440476 CAGCTCTACGCCATGAAGGT Chr17:7440434..7440453 60.42 55
upstream ENSMUSE00000556272 Chr17:7451051..7451131 GAGAGACATCCTGGCAGAGG Chr17:7451079..7451098 59.94 60
upstream ENSMUSE00000511456 Chr17:7453641..7453720 TGACCTCTTCACCAGGCTTT Chr17:7453693..7453712 59.84 50
upstream ENSMUSE00000447082 Chr17:7455889..7455995 TGGCTCTAGACCACCTCCAT Chr17:7455938..7455957 59.68 55
upstream ENSMUSE00000500940 Chr17:7458761..7458798 TCCTGGATGAAGAGGGACAC Chr17:7458766..7458785 60.05 55
upstream ENSMUSE00000556258 Chr17:7460180..7460322 ACCGACCATGACAAGAGAGC Chr17:7460203..7460222 60.27 55
upstream ENSMUSE00000658407 Chr17:7463460..7463486 CATCGTGCACACTTCAGGTT Chr17:7463465..7463484 59.75 50
upstream ENSMUSE00000507879 Chr17:7465353..7465423 AAGGAAACAATGGCCCTCAT Chr17:7465398..7465417 60.69 45
upstream ENSMUSE00000482414 Chr17:7466477..7466565 GGGTATGCCTCAGTTCCTCA Chr17:7466486..7466505 60.07 55
upstream ENSMUSE00000556248 Chr17:7475941..7476005 AACGTCACCCGTTCTTTGTC Chr17:7475971..7475990 60.01 50

*** Putative Vector Insertion (Chr 17: 7476006 - 7481811) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000503144 Chr17:7481812..7481914 TAAACTCGGGGTCAAAGTGG Chr17:7481899..7481918 59.96 50
downstream ENSMUSE00000504173 Chr17:7486118..7486248 AGGCCACAAAGCTGAATCCT Chr17:7486186..7486205 61.15 50
downstream ENSMUSE00000503691 Chr17:7487093..7487218 GTACACACCGCTTGCACACT Chr17:7487189..7487208 59.83 55
downstream ENSMUSE00000499964 Chr17:7493264..7493353 ATAGCGCAGGAGGATCTCAA Chr17:7493323..7493342 59.94 50
downstream ENSMUSE00000484323 Chr17:7494979..7495137 TCCTGGCGATGGTATAGAGC Chr17:7495114..7495133 60.2 55
downstream ENSMUSE00000556220 Chr17:7495189..7495212 No primer for this exon
downstream ENSMUSE00000556228 Chr17:7497095..7497256 AGATTCGGGGTTTCCAGACT Chr17:7497163..7497182 59.94 50
downstream ENSMUSE00000460422 Chr17:7499552..7499628 GTACAGCAGGATTCCCAAGC Chr17:7499617..7499636 59.7 55
downstream ENSMUSE00000478069 Chr17:7500364..7500481 CTCCTCAGGGGTATCGTCTG Chr17:7500409..7500428 59.67 60
downstream ENSMUSE00000135540 Chr17:7503632..7503769 AACTGCTGTTAGGCGTTGCT Chr17:7503688..7503707 60.08 50
downstream ENSMUSE00000475355 Chr17:7504565..7507662 CAACAGGAATCACGCTCTCA Chr17:7505349..7505368 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr17:7479057..7479077 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTACACACAGGGCAAGGA Chr17:7479031..7479051 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023809