Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26822
Trapped Gene
Zfp322a (ENSMUSG00000046351)
Vector Insertion
Chr 13: 23454745 - 23459988
Public Clones not available
Private Clones OST93365 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000397773 (Chr13:23459989..23460074 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000397773 (Chr13:23459989..23460074 -)
Downstram Exon
ENSMUSE00000356847 (Chr13:23454672..23454744 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGATGAAAAGCAGCCTTCAC Chr13:23454662..23454682 60.01 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000370817 Chr13:23461004..23461077 GTGAGAGCGGTTTGTCTTGG Chr13:23461034..23461053 60.83 55
upstream ENSMUSE00000397773 Chr13:23459989..23460074 No primer for this exon

*** Putative Vector Insertion (Chr 13: 23454745 - 23459988) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000356847 Chr13:23454672..23454744 CAGATGAAAAGCAGCCTTCAC Chr13:23454662..23454682 60.01 47.62
downstream ENSMUSE00000394779 Chr13:23446715..23449582 CAGACCGGTGTCGGTAACTT Chr13:23448715..23448734 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr13:23459918..23459938 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGGAGTAGGGACGTGACTG Chr13:23459929..23459950 60.16 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046351