Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26831
Trapped Gene
Immp1l (ENSMUSG00000042670)
Vector Insertion
Chr 2: 105777276 - 105804336
Public Clones not available
Private Clones OST92453 (lexicon) OST92357 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224185 (Chr2:105777149..105777275 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATTGCAAAAAGCCCAAGTG Chr2:105777161..105777180 60.11 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224185 (Chr2:105777149..105777275 +)
Downstram Exon
ENSMUSE00000224176 (Chr2:105804337..105804447 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATTGCAAAAAGCCCAAGTG Chr2:105777161..105777180 60.11 40 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340821 Chr2:105744836..105744887 CCGAGGAACTTCTGTTGGTG Chr2:105744855..105744874 60.68 55
upstream ENSMUSE00000413144 Chr2:105748481..105748586 GCTTTGAGACCTCCGTCAGA Chr2:105748510..105748529 60.53 55
upstream ENSMUSE00000224199 Chr2:105770876..105771009 TATGCTTCGTGGTGTTCTGG Chr2:105770904..105770923 59.72 50
upstream ENSMUSE00000224191 Chr2:105773422..105773510 TCAATGGAACCCACAATTCA Chr2:105773434..105773453 59.75 40
upstream ENSMUSE00000224185 Chr2:105777149..105777275 AATTGCAAAAAGCCCAAGTG Chr2:105777161..105777180 60.11 40

*** Putative Vector Insertion (Chr 2: 105777276 - 105804336) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224176 Chr2:105804337..105804447 No primer for this exon
downstream ENSMUSE00000344184 Chr2:105805421..105805574 GTCACGCAGAAATCCGAAGT Chr2:105805459..105805478 60.26 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:105783326..105783346 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATGAGTTTGGGCTTTGGA Chr2:105777232..105777252 59.55 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042670