Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26839
Trapped Gene
Morn3 (ENSMUSG00000029477)
Vector Insertion
Chr 5: 123487870 - 123489265
Public Clones IST14856G6 (tigm) IST12997D4 (tigm) IST14012E3 (tigm) IST10814G10 (tigm)
IST14333F10 (tigm) IST13958H12 (tigm)
Private Clones OST92155 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189240 (Chr5:123489266..123489425 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTTTCGGACCCAAGGAGT Chr5:123489392..123489411 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189240 (Chr5:123489266..123489425 -)
Downstram Exon
ENSMUSE00000328409 (Chr5:123487685..123487869 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTTTCGGACCCAAGGAGT Chr5:123489392..123489411 60.34 50 GTCCACCCAGTAGCCTTCAA Chr5:123487741..123487760 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497370 Chr5:123496640..123496829 AAAGCCCAGAAGAACGGACT Chr5:123496708..123496727 60.25 50
upstream ENSMUSE00000649828 Chr5:123491092..123491249 GGAAGCGAGATGGTTATGGA Chr5:123491170..123491189 60.04 50
upstream ENSMUSE00000189240 Chr5:123489266..123489425 GTTTTTCGGACCCAAGGAGT Chr5:123489392..123489411 60.34 50

*** Putative Vector Insertion (Chr 5: 123487870 - 123489265) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000328409 Chr5:123487685..123487869 GTCCACCCAGTAGCCTTCAA Chr5:123487741..123487760 60.11 55
downstream ENSMUSE00000495618 Chr5:123487142..123487369 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50
downstream ENSMUSE00000537470 Chr5:123487142..123487369 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTTGCGGCTGAGTGAGTG Chr5:123489257..123489277 62.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTTGCGGCTGAGTGAGTG Chr5:123489257..123489277 62.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGGCTATGGGATCCAGTTT Chr5:123489406..123489426 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGTCGTGACTGGGAAAACC Chr5:123489359..123489379 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029477