Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26845
Trapped Gene
Hnrph2 (ENSMUSG00000045427)
Vector Insertion
Chr X: 131137502 - 131139393
Public Clones not available
Private Clones OST91827 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444073 (ChrX:131137457..131137501 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCACATACCTGAAGTGGA ChrX:131137468..131137487 58.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444073 (ChrX:131137457..131137501 +)
Downstram Exon
ENSMUSE00000694756 (ChrX:131139394..131140923 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCACATACCTGAAGTGGA ChrX:131137468..131137487 58.16 50 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694763 ChrX:131135718..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000694761 ChrX:131135764..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000487488 ChrX:131135797..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000694758 ChrX:131135810..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000444079 ChrX:131135825..131135872 TAGCCGTTTGAGGGAAGAAG ChrX:131135826..131135845 59.45 50
upstream ENSMUSE00000381195 ChrX:131137231..131137301 No primer for this exon
upstream ENSMUSE00000694757 ChrX:131137239..131137301 No primer for this exon
upstream ENSMUSE00000444073 ChrX:131137457..131137501 AGGCACATACCTGAAGTGGA ChrX:131137468..131137487 58.16 50
upstream ENSMUSE00000694759 ChrX:131137457..131141297 TATCTGTGCACGCTTTGAGG ChrX:131137922..131137941 60.01 50

*** Putative Vector Insertion (Chr X: 131137502 - 131139393) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000653740 ChrX:131139394..131141593 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55
downstream ENSMUSE00000694756 ChrX:131139394..131140923 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55
downstream ENSMUSE00000694760 ChrX:131139394..131141599 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55
downstream ENSMUSE00000694767 ChrX:131139394..131141585 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT ChrX:131137552..131137572 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCACATACCTGAAGTGGA ChrX:131137469..131137489 58.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045427