Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26849
Trapped Gene
Ccdc12 (ENSMUSG00000019659)
Vector Insertion
Chr 9: 110611030 - 110612397
Public Clones not available
Private Clones OST91593 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220088 (Chr9:110610950..110611029 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220088 (Chr9:110610950..110611029 +)
Downstram Exon
ENSMUSE00000220093 (Chr9:110612398..110612459 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220094 Chr9:110559057..110559162 No primer for this exon
upstream ENSMUSE00000305810 Chr9:110594820..110594887 No primer for this exon
upstream ENSMUSE00000220088 Chr9:110610950..110611029 No primer for this exon

*** Putative Vector Insertion (Chr 9: 110611030 - 110612397) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220093 Chr9:110612398..110612459 No primer for this exon
downstream ENSMUSE00000220091 Chr9:110612631..110612665 No primer for this exon
downstream ENSMUSE00000220089 Chr9:110613590..110613666 No primer for this exon
downstream ENSMUSE00000447808 Chr9:110613755..110614094 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:110611080..110611100 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTCAGAGAAGACGTGAC Chr9:110611067..110611087 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019659