Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26851
Trapped Gene
Ostb (ENSMUSG00000053862)
Vector Insertion
Chr 9: 65263095 - 65270553
Public Clones not available
Private Clones OST91285 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636032 (Chr9:65270554..65270762 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGGAAGAGTTCCTGTGAGG Chr9:65270623..65270642 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636032 (Chr9:65270554..65270762 -)
Downstram Exon
ENSMUSE00000422571 (Chr9:65262974..65263094 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGGAAGAGTTCCTGTGAGG Chr9:65270623..65270642 60.38 55 GCATTTCTTCCAGCAGTTCC Chr9:65262976..65262995 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636032 Chr9:65270554..65270762 TCGGAAGAGTTCCTGTGAGG Chr9:65270623..65270642 60.38 55

*** Putative Vector Insertion (Chr 9: 65263095 - 65270553) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000422571 Chr9:65262974..65263094 GCATTTCTTCCAGCAGTTCC Chr9:65262976..65262995 59.82 50
downstream ENSMUSE00000422553 Chr9:65261731..65261821 CCTTCTCAGGAGGAACATGC Chr9:65261726..65261745 59.8 55
downstream ENSMUSE00000422560 Chr9:65260521..65260808 TAAGTTAGGCGGCGTTATGG Chr9:65260535..65260554 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCTGAAGTCCCAGGAATC Chr9:65264563..65264583 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTGAAGTCCCAGGAATC Chr9:65264563..65264583 60.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053862