Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26859
Trapped Gene
Mpi (ENSMUSG00000032306)
Vector Insertion
Chr 9: 57400082 - 57400510
Public Clones not available
Private Clones OST90588 (lexicon) OST37546 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698483 (Chr9:57400511..57400559 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTCAGGCAACTGGGATGG Chr9:57400523..57400542 62.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698483 (Chr9:57400511..57400559 -)
Downstram Exon
ENSMUSE00000503542 (Chr9:57399954..57400081 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTCAGGCAACTGGGATGG Chr9:57400523..57400542 62.76 55 AGGCATGCCACTTCACTTTT Chr9:57399987..57400006 59.74 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698483 Chr9:57400511..57400559 GTTTCAGGCAACTGGGATGG Chr9:57400523..57400542 62.76 55

*** Putative Vector Insertion (Chr 9: 57400082 - 57400510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000503542 Chr9:57399954..57400081 AGGCATGCCACTTCACTTTT Chr9:57399987..57400006 59.74 45
downstream ENSMUSE00000218573 Chr9:57398380..57398580 TCAAGGATCTTGGCATCTCC Chr9:57398515..57398534 60.16 50
downstream ENSMUSE00000218572 Chr9:57396844..57396985 GTTGGCATCAGGGTAGTGCT Chr9:57396910..57396929 60.14 55
downstream ENSMUSE00000218575 Chr9:57396335..57396517 AGATCCGTTTCACCAACAGG Chr9:57396322..57396341 59.97 50
downstream ENSMUSE00000218576 Chr9:57394201..57394374 GGCGAAACATCCGATATCAC Chr9:57394264..57394283 60.3 50
downstream ENSMUSE00000218580 Chr9:57393002..57393210 GGGTTGGCACATCAATGAAT Chr9:57393111..57393130 60.59 45
downstream ENSMUSE00000636567 Chr9:57392075..57392745 TCAGCTAGGGCAGAGTGGTT Chr9:57392221..57392240 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGCCGTTTACCCATGTTA Chr9:57400488..57400509 59.88 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGCCGTTTACCCATGTTA Chr9:57400488..57400509 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032306