Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26865
Trapped Gene
Hspa8 (ENSMUSG00000015656)
Vector Insertion
Chr 9: 40610975 - 40611056
Public Clones not available
Private Clones OST90436 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708431 (Chr9:40610879..40610974 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708431 (Chr9:40610879..40610974 +)
Downstram Exon
ENSMUSE00000584669 (Chr9:40611057..40611612 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720065 Chr9:40609318..40609431 No primer for this exon
upstream ENSMUSE00000536258 Chr9:40609359..40609431 No primer for this exon
upstream ENSMUSE00000716002 Chr9:40609385..40609431 No primer for this exon
upstream ENSMUSE00000584671 Chr9:40610001..40610210 No primer for this exon
upstream ENSMUSE00000713188 Chr9:40610001..40610210 No primer for this exon
upstream ENSMUSE00000584670 Chr9:40610501..40610706 No primer for this exon
upstream ENSMUSE00000718522 Chr9:40610501..40610601 No primer for this exon
upstream ENSMUSE00000215902 Chr9:40610822..40610974 No primer for this exon
upstream ENSMUSE00000708431 Chr9:40610879..40610974 No primer for this exon

*** Putative Vector Insertion (Chr 9: 40610975 - 40611056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584669 Chr9:40611057..40611612 No primer for this exon
downstream ENSMUSE00000584668 Chr9:40611823..40612025 No primer for this exon
downstream ENSMUSE00000584667 Chr9:40612248..40612446 No primer for this exon
downstream ENSMUSE00000215906 Chr9:40612546..40612778 No primer for this exon
downstream ENSMUSE00000584666 Chr9:40613015..40613282 No primer for this exon
downstream ENSMUSE00000708812 Chr9:40613015..40613283 No primer for this exon
downstream ENSMUSE00000715472 Chr9:40613103..40613283 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAATGAACCAACTGCTGCT Chr9:40610929..40610949 59.44 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAATGAACCAACTGCTGCT Chr9:40610929..40610949 59.44 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015656