Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26868
Trapped Gene
P2rx7 (ENSMUSG00000029468)
Vector Insertion
Chr 5: 123104239 - 123104987
Public Clones not available
Private Clones OST90373 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189155 (Chr5:123104170..123104238 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCAGAAGGCCAAGTGCAG Chr5:123104204..123104223 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189155 (Chr5:123104170..123104238 +)
Downstram Exon
ENSMUSE00000537763 (Chr5:123104988..123105238 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCAGAAGGCCAAGTGCAG Chr5:123104204..123104223 60.59 55 GAACTACCAGGAGGCAGCAG Chr5:123105113..123105132 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000537791 Chr5:123093920..123094207 TCCTAGGTGAGGGTTTGCTG Chr5:123094002..123094021 60.25 55
upstream ENSMUSE00000709731 Chr5:123093920..123094207 TCCTAGGTGAGGGTTTGCTG Chr5:123094002..123094021 60.25 55
upstream ENSMUSE00000330124 Chr5:123102736..123102904 AAGCTGTACCAGCGGAAAGA Chr5:123102755..123102774 60.01 50
upstream ENSMUSE00000189155 Chr5:123104170..123104238 AGTCAGAAGGCCAAGTGCAG Chr5:123104204..123104223 60.59 55

*** Putative Vector Insertion (Chr 5: 123104239 - 123104987) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000537763 Chr5:123104988..123105238 GAACTACCAGGAGGCAGCAG Chr5:123105113..123105132 60.01 60
downstream ENSMUSE00000189149 Chr5:123107021..123107093 CTTTTTACAACGCCGGTCAG Chr5:123107071..123107090 60.66 50
downstream ENSMUSE00000189150 Chr5:123108717..123108813 ACACCTGCCAGTCTGGATTC Chr5:123108739..123108758 60.12 55
downstream ENSMUSE00000189152 Chr5:123113586..123113666 No primer for this exon
downstream ENSMUSE00000410058 Chr5:123114554..123114683 TGTCCCCTAGTCGGAAGATG Chr5:123114642..123114661 60.06 55
downstream ENSMUSE00000338329 Chr5:123116153..123116289 GACGAAGGACTCATCCGTGT Chr5:123116275..123116294 60.12 55
downstream ENSMUSE00000381471 Chr5:123120447..123120537 CTTTGATCAACGTCCGCTTT Chr5:123120502..123120521 60.25 45
downstream ENSMUSE00000371551 Chr5:123123364..123123429 AACCAGCTGGATGATGTCAA Chr5:123123396..123123415 59.09 45
downstream ENSMUSE00000330092 Chr5:123123675..123123824 TGAGCAAGTCAATGCACACA Chr5:123123702..123123721 60.03 45
downstream ENSMUSE00000189148 Chr5:123126671..123126772 CTTGCAGACTTTTCCCAAGC Chr5:123126752..123126771 59.99 50
downstream ENSMUSE00000649889 Chr5:123130816..123134293 TAAGGCAGCAGAGTGGTCCT Chr5:123132110..123132129 60.01 55
downstream ENSMUSE00000719705 Chr5:123133184..123134306 GGTCATCCGTCTGAGGTCAT Chr5:123133433..123133452 59.93 55
downstream ENSMUSE00000649890 Chr5:123141262..123141441 CGACCACTTGCTGTTTTTGA Chr5:123141424..123141443 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGGACCCACTCTGATAGG Chr5:123104246..123104266 60.33 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGGACCCACTCTGATAGG Chr5:123104246..123104266 60.33 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029468