Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26880
Trapped Gene
Apeh (ENSMUSG00000032590)
Vector Insertion
Chr 9: 107995406 - 107995952
Public Clones not available
Private Clones OST88678 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000380041 (Chr9:107995953..107996079 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACTTGGATCGAATGGAGA Chr9:107996047..107996066 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000380041 (Chr9:107995953..107996079 -)
Downstram Exon
ENSMUSE00000345219 (Chr9:107995312..107995405 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACTTGGATCGAATGGAGA Chr9:107996047..107996066 60.01 50 TTTTTCCTCTCCCGAGACTG Chr9:107995302..107995321 59.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459552 Chr9:107996766..107996797 CCGAAAGACCGACTATGGAG Chr9:107996772..107996791 59.69 55
upstream ENSMUSE00000246472 Chr9:107996558..107996690 No primer for this exon
upstream ENSMUSE00000380041 Chr9:107995953..107996079 GGACTTGGATCGAATGGAGA Chr9:107996047..107996066 60.01 50

*** Putative Vector Insertion (Chr 9: 107995406 - 107995952) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345219 Chr9:107995312..107995405 TTTTTCCTCTCCCGAGACTG Chr9:107995302..107995321 59.4 50
downstream ENSMUSE00000221231 Chr9:107995138..107995213 CTCTTGAGCTTGCGGTTCTT Chr9:107995163..107995182 59.76 50
downstream ENSMUSE00000221235 Chr9:107994885..107995048 TTCTCCGCCACATACAACAA Chr9:107994966..107994985 60.11 45
downstream ENSMUSE00000221246 Chr9:107994607..107994744 GACCAGGGGACACATTTTCA Chr9:107994587..107994606 60.76 50
downstream ENSMUSE00000221243 Chr9:107994419..107994510 ATACCTAGCCGGAAGGGTTC Chr9:107994418..107994437 59.44 55
downstream ENSMUSE00000221242 Chr9:107994302..107994342 No primer for this exon
downstream ENSMUSE00000221236 Chr9:107994099..107994220 ACTGGTGATGAGGGGCTAGA Chr9:107994094..107994113 59.68 55
downstream ENSMUSE00000221229 Chr9:107993574..107993634 ATGTCCACCACCAATGAGGT Chr9:107993572..107993591 60.1 50
downstream ENSMUSE00000221228 Chr9:107992420..107992517 CCGAGTCGAAGACCACTCTC Chr9:107992415..107992434 59.99 60
downstream ENSMUSE00000221237 Chr9:107991849..107991900 GCTGTCAGGGAGGTGACACT Chr9:107991829..107991848 60.31 60
downstream ENSMUSE00000221241 Chr9:107990592..107990680 CCACCATAAGGTCTCGGTCA Chr9:107990605..107990624 60.91 55
downstream ENSMUSE00000221227 Chr9:107990054..107990192 CACCCATGACACAGACTGCT Chr9:107990120..107990139 59.74 55
downstream ENSMUSE00000221230 Chr9:107989512..107989595 CATGACTACCATGGGGACCT Chr9:107989497..107989516 59.65 55
downstream ENSMUSE00000355963 Chr9:107989354..107989434 ATCCAGGCAGTGACAAAGGA Chr9:107989379..107989398 60.66 50
downstream ENSMUSE00000221247 Chr9:107988754..107988842 TGGACATCCTTCACATCCTG Chr9:107988733..107988752 59.47 50
downstream ENSMUSE00000221232 Chr9:107988470..107988660 TCTGGGTATTGACCAATCAGG Chr9:107988526..107988546 59.8 47.62
downstream ENSMUSE00000221240 Chr9:107988281..107988383 GGAAGCCAGTCTCCACCATA Chr9:107988339..107988358 60.07 55
downstream ENSMUSE00000221239 Chr9:107988092..107988198 GACCCTGCTTGAAGGGTACA Chr9:107988113..107988132 60.11 55
downstream ENSMUSE00000508429 Chr9:107987748..107988008 TCCATAGTCCTCTGCCCACT Chr9:107987751..107987770 59.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGGAGTAAGTGTGACAGG Chr9:107995937..107995957 59.42 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGGAGTAAGTGTGACAGG Chr9:107995937..107995957 59.42 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032590