Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26884
Trapped Gene
Pik3r4 (ENSMUSG00000032571)
Vector Insertion
Chr 9: 105545721 - 105546525
Public Clones IST14479B10 (tigm)
Private Clones OST88295 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000451179 (Chr9:105545325..105545720 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGATCTTTCAGCGACTTT Chr9:105545681..105545700 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000451179 (Chr9:105545325..105545720 +)
Downstram Exon
ENSMUSE00000264950 (Chr9:105546526..105547299 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGATCTTTCAGCGACTTT Chr9:105545681..105545700 59.81 45 GGGATCCTGAATTGCAAAGA Chr9:105546749..105546768 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451179 Chr9:105545325..105545720 TGGGATCTTTCAGCGACTTT Chr9:105545681..105545700 59.81 45

*** Putative Vector Insertion (Chr 9: 105545721 - 105546525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264950 Chr9:105546526..105547299 GGGATCCTGAATTGCAAAGA Chr9:105546749..105546768 60.01 45
downstream ENSMUSE00000264924 Chr9:105550996..105551129 ACAAAGGTACGCCTTCCGTA Chr9:105551040..105551059 59.63 50
downstream ENSMUSE00000264906 Chr9:105552647..105553229 TTATCACGGACACCAGGACA Chr9:105552929..105552948 59.96 50
downstream ENSMUSE00000264886 Chr9:105556282..105556416 GTTTTCAGCTGCACAAGCTC Chr9:105556345..105556364 58.8 50
downstream ENSMUSE00000264859 Chr9:105557146..105557367 TCCATCAGCGTCTGTTTCAC Chr9:105557236..105557255 59.84 50
downstream ENSMUSE00000341238 Chr9:105560749..105560922 CACTGGCGAACTCGTAGACA Chr9:105560919..105560938 60.05 55
downstream ENSMUSE00000509144 Chr9:105563667..105563812 GCCATAGCGTATCCACAGGT Chr9:105563710..105563729 59.99 55
downstream ENSMUSE00000517212 Chr9:105565372..105565575 TCAGAAGTTGCGCTATGGTG Chr9:105565561..105565580 60.01 50
downstream ENSMUSE00000515221 Chr9:105570062..105570263 GGCTCTGGTCTACCGCATTA Chr9:105570158..105570177 60.24 55
downstream ENSMUSE00000514338 Chr9:105571316..105571503 CAGAGGACTCAGAGCGAGGT Chr9:105571471..105571490 59.73 60
downstream ENSMUSE00000519190 Chr9:105572076..105572286 TACTCACAACCGGGATCACA Chr9:105572133..105572152 59.96 50
downstream ENSMUSE00000518336 Chr9:105574974..105575139 TGATGCGATTCACAGCAGAT Chr9:105575042..105575061 60.39 45
downstream ENSMUSE00000491637 Chr9:105579073..105579237 GAGCCTTGGCAAAACGTTAG Chr9:105579138..105579157 59.88 50
downstream ENSMUSE00000583406 Chr9:105580439..105580650 CATCCAACCAGAGAGCCATT Chr9:105580549..105580568 60.07 50
downstream ENSMUSE00000583405 Chr9:105584515..105584646 CTGGAACCTCATGTCCCAAC Chr9:105584561..105584580 60.36 55
downstream ENSMUSE00000530396 Chr9:105587461..105587561 CAGTCTCCTGTCGCCAGTTT Chr9:105587522..105587541 60.44 55
downstream ENSMUSE00000530395 Chr9:105588464..105588552 CAGCAGGATAGGGTTTCCAT Chr9:105588529..105588548 59.01 50
downstream ENSMUSE00000530394 Chr9:105588676..105588784 GAACCTGTACTTCCCGCAAC Chr9:105588735..105588754 59.6 55
downstream ENSMUSE00000530391 Chr9:105589445..105589985 GTCGGCAGGACTTATTTCCA Chr9:105589629..105589648 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCCCTGGGATCTTTCAG Chr9:105545675..105545695 60.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTCCCTGGGATCTTTCAG Chr9:105545675..105545695 60.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032571