Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26889
Trapped Gene
Crebzf (ENSMUSG00000051451)
Vector Insertion
Chr 7: 97592598 - 97592809
Public Clones not available
Private Clones OST88063 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672407 (Chr7:97592180..97592597 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCGTCGTCGTCTCTTAAA Chr7:97592576..97592595 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672407 (Chr7:97592180..97592597 +)
Downstram Exon
ENSMUSE00000672405 (Chr7:97592810..97592886 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCGTCGTCGTCTCTTAAA Chr7:97592576..97592595 60.01 50 CGGGAACGACTGCTCTGTAA Chr7:97592878..97592897 61.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354308 Chr7:97591239..97594614 GCTCCGTTGTAGGGGTTACA Chr7:97592841..97592860 59.99 55
upstream ENSMUSE00000672408 Chr7:97591291..97596227 GCTCCGTTGTAGGGGTTACA Chr7:97592841..97592860 59.99 55
upstream ENSMUSE00000672407 Chr7:97592180..97592597 AGGCGTCGTCGTCTCTTAAA Chr7:97592576..97592595 60.01 50

*** Putative Vector Insertion (Chr 7: 97592598 - 97592809) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672405 Chr7:97592810..97592886 CGGGAACGACTGCTCTGTAA Chr7:97592878..97592897 61.36 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGCTCTTTATCCGCGTTT Chr7:97592613..97592633 59.98 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGCTCTTTATCCGCGTTT Chr7:97592613..97592633 59.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051451