Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26898
Trapped Gene
Tgfbr3 (ENSMUSG00000029287)
Vector Insertion
Chr 5: 107578978 - 107583270
Public Clones not available
Private Clones OST87619 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314181 (Chr5:107583271..107583454 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTCCAGTTTTCATCAGGA Chr5:107583419..107583438 59.06 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314181 (Chr5:107583271..107583454 -)
Downstram Exon
ENSMUSE00000314173 (Chr5:107578809..107578977 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTCCAGTTTTCATCAGGA Chr5:107583419..107583438 59.06 45 TTGAAGGTACTCCGCAAGGT Chr5:107578882..107578901 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000498262 Chr5:107718274..107718539 TCCCTGGCAGTGAGAGAGAG Chr5:107718501..107718520 60.69 60
upstream ENSMUSE00000497185 Chr5:107695213..107695369 TAAGGCTACACCCGACTTGC Chr5:107695322..107695341 60.27 55
upstream ENSMUSE00000314194 Chr5:107643912..107644096 AGCTTCACCGTTCTGTCTGG Chr5:107644006..107644025 60.44 55
upstream ENSMUSE00000314187 Chr5:107606824..107606961 CCTGTTGTGTTCCTGCTCAA Chr5:107606894..107606913 59.87 50
upstream ENSMUSE00000314181 Chr5:107583271..107583454 TGGTCCAGTTTTCATCAGGA Chr5:107583419..107583438 59.06 45

*** Putative Vector Insertion (Chr 5: 107578978 - 107583270) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314173 Chr5:107578809..107578977 TTGAAGGTACTCCGCAAGGT Chr5:107578882..107578901 59.73 50
downstream ENSMUSE00000314164 Chr5:107577045..107577192 CTCGAGCAGGTCGTATGTCA Chr5:107577127..107577146 60.01 55
downstream ENSMUSE00000187725 Chr5:107571376..107571565 TGTTCTCAAGCCGAAGATGA Chr5:107571357..107571376 59.52 45
downstream ENSMUSE00000187741 Chr5:107569403..107569731 ATCCGAAGCTCAGGAGGAAT Chr5:107569661..107569680 60.18 50
downstream ENSMUSE00000187734 Chr5:107568788..107568940 TCAGCGGAGACTCCAGTACA Chr5:107568825..107568844 59.57 55
downstream ENSMUSE00000187737 Chr5:107566549..107566689 TCACCCGACTCCAAATCTTC Chr5:107566594..107566613 60.05 50
downstream ENSMUSE00000187736 Chr5:107565938..107566096 ATTTCCATCGAGCTGGTCCT Chr5:107566012..107566031 60.99 50
downstream ENSMUSE00000187739 Chr5:107561752..107562048 TCGGACAGATGTTCTCGATG Chr5:107561909..107561928 59.79 50
downstream ENSMUSE00000187727 Chr5:107559480..107559597 TCATGGTCCAGATCATGGTG Chr5:107559518..107559537 60.34 50
downstream ENSMUSE00000509353 Chr5:107550379..107550426 CGGACTGGACTCCTTCATGT Chr5:107550373..107550392 60.11 55
downstream ENSMUSE00000508351 Chr5:107547438..107547545 GAGTGCTCCGATCACAAATG Chr5:107547453..107547472 59.24 50
downstream ENSMUSE00000507352 Chr5:107535591..107538776 TGAGTGCTCCCTATGCTGTG Chr5:107538670..107538689 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGGTTCATTCCCCTTCTG Chr5:107580223..107580243 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGGTTCATTCCCCTTCTG Chr5:107580223..107580243 60.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029287