Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26906
Trapped Gene
Adamts14 (ENSMUSG00000059901)
Vector Insertion
Chr 10: 60684755 - 60685531
Public Clones not available
Private Clones OST86841 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576046 (Chr10:60685532..60685645 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCATACTTCTGCAAGACCAA Chr10:60685575..60685595 60.12 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576046 (Chr10:60685532..60685645 -)
Downstram Exon
ENSMUSE00000486699 (Chr10:60684606..60684754 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCATACTTCTGCAAGACCAA Chr10:60685575..60685595 60.12 47.62 CACACGACCGAGAACATGAG Chr10:60684627..60684646 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666275 Chr10:60735904..60736186 No primer for this exon
upstream ENSMUSE00000713901 Chr10:60735904..60735990 No primer for this exon
upstream ENSMUSE00000576050 Chr10:60733605..60734005 AGATTTCCAGGGACGCTTCT Chr10:60733931..60733950 60.21 50
upstream ENSMUSE00000576049 Chr10:60712352..60712508 TGGTGACCTTCACAACGAAG Chr10:60712352..60712371 59.72 50
upstream ENSMUSE00000576048 Chr10:60708674..60708864 CAGGGAGCATACGCAGAACT Chr10:60708697..60708716 60.42 55
upstream ENSMUSE00000482142 Chr10:60693166..60693249 No primer for this exon
upstream ENSMUSE00000576042 Chr10:60692404..60692551 CTGAACATCACGACCACGTC Chr10:60692438..60692457 60.16 55
upstream ENSMUSE00000717226 Chr10:60692395..60692551 CTGAACATCACGACCACGTC Chr10:60692438..60692457 60.16 55
upstream ENSMUSE00000576047 Chr10:60689855..60689960 GCCACCCACTAAGAAGCTGT Chr10:60689917..60689936 59.36 55
upstream ENSMUSE00000491823 Chr10:60688085..60688228 CCACAGGTTCCACTGGTCTC Chr10:60688119..60688138 60.56 60
upstream ENSMUSE00000490386 Chr10:60687021..60687153 ACGATTGCCTCCTTGATGAC Chr10:60687129..60687148 60.08 50
upstream ENSMUSE00000576046 Chr10:60685532..60685645 CCCATACTTCTGCAAGACCAA Chr10:60685575..60685595 60.12 47.62

*** Putative Vector Insertion (Chr 10: 60684755 - 60685531) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000486699 Chr10:60684606..60684754 CACACGACCGAGAACATGAG Chr10:60684627..60684646 60.31 55
downstream ENSMUSE00000484980 Chr10:60681106..60681281 CTCAAACATGGACCCTGAGC Chr10:60681217..60681236 60.66 55
downstream ENSMUSE00000507297 Chr10:60676278..60676411 CCCATCGTGGACTACTTGGT Chr10:60676310..60676329 59.84 55
downstream ENSMUSE00000513248 Chr10:60675872..60675995 GCACTTGTCATCCGTCTTCA Chr10:60675923..60675942 59.84 50
downstream ENSMUSE00000512229 Chr10:60674336..60674416 GGGATCTGCACCTGTTTGAG Chr10:60674370..60674389 60.66 55
downstream ENSMUSE00000518023 Chr10:60670048..60670211 CTTCGTGCTCCCACTCTAGG Chr10:60670088..60670107 60.01 60
downstream ENSMUSE00000509589 Chr10:60668112..60668280 GCCCATTCGTAGGTGTCTGT Chr10:60668131..60668150 60 55
downstream ENSMUSE00000508548 Chr10:60667595..60667727 AGGCTTGGGCCTCTTTTTAT Chr10:60667614..60667633 59.22 45
downstream ENSMUSE00000500118 Chr10:60665571..60665778 CTACAGGCACCCCACTCTTC Chr10:60665727..60665746 59.72 60
downstream ENSMUSE00000505959 Chr10:60663924..60664053 No primer for this exon
downstream ENSMUSE00000511920 Chr10:60663111..60663221 ACCTCCGCCTTCACTGTAGA Chr10:60663166..60663185 59.87 55
downstream ENSMUSE00000712810 Chr10:60661216..60661707 ACGGTCCAACACTTCCATTC Chr10:60661630..60661649 59.83 50
downstream ENSMUSE00000576036 Chr10:60659860..60661707 CTGGTCTAACCAGGGACCAA Chr10:60660411..60660430 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000059901