Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26924
Trapped Gene
Sumo3 (ENSMUSG00000020265)
Vector Insertion
Chr 10: 77069714 - 77072556
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(ggtc) (ggtc) CMHD-GT_516A2-5S (cmhd) CMHD-GT_516A2-3 (cmhd) IST11604B12 (tigm)
IST14981D1 (tigm)
Private Clones OST85085 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642249 (Chr10:77069693..77069713 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642249 (Chr10:77069693..77069713 +)
Downstram Exon
ENSMUSE00000327617 (Chr10:77072557..77072685 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353516 Chr10:77068979..77069086 No primer for this exon
upstream ENSMUSE00000642249 Chr10:77069693..77069713 No primer for this exon

*** Putative Vector Insertion (Chr 10: 77069714 - 77072556) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000327617 Chr10:77072557..77072685 No primer for this exon
downstream ENSMUSE00000102722 Chr10:77076725..77076796 No primer for this exon
downstream ENSMUSE00000415463 Chr10:77078893..77080165 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGACCACTGTGTTGGCTCA Chr10:77069694..77069714 60.16 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACCACTGTGTTGGCTCA Chr10:77069694..77069714 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020265