Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26926
Trapped Gene
Bat3 (ENSMUSG00000024392)
Vector Insertion
Chr 17: 35273181 - 35275316
Public Clones D075B05 (ggtc) D076E08 (ggtc) D075G09 (ggtc) D076C07 (ggtc) D075D06 (ggtc)
D076C07 (ggtc)
Private Clones OST85067 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345660 (Chr17:35273060..35273180 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCGAGTGATAGTGCCAGT Chr17:35273077..35273096 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345660 (Chr17:35273060..35273180 +)
Downstram Exon
ENSMUSE00000607957 (Chr17:35275317..35275434 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCGAGTGATAGTGCCAGT Chr17:35273077..35273096 59.9 55 GGTAGATGAGCCGCTGTTTC Chr17:35275395..35275414 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480073 Chr17:35272187..35272416 AGTAAATCGGGGGAGACTGG Chr17:35272303..35272322 60.32 55
upstream ENSMUSE00000697507 Chr17:35272204..35272416 AGTAAATCGGGGGAGACTGG Chr17:35272303..35272322 60.32 55
upstream ENSMUSE00000345660 Chr17:35273060..35273180 AGCCGAGTGATAGTGCCAGT Chr17:35273077..35273096 59.9 55

*** Putative Vector Insertion (Chr 17: 35273181 - 35275316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000607957 Chr17:35275317..35275434 GGTAGATGAGCCGCTGTTTC Chr17:35275395..35275414 59.84 55
downstream ENSMUSE00000607956 Chr17:35275531..35275727 CATGAGTTGCTGAGGCAGAG Chr17:35275635..35275654 59.73 55
downstream ENSMUSE00000607955 Chr17:35275968..35276021 GTGAACATCCACAGCAGAGC Chr17:35275997..35276016 59.42 55
downstream ENSMUSE00000607954 Chr17:35276180..35276254 TCCGGGACAGTAAGGTCTGT Chr17:35276252..35276271 59.57 55
downstream ENSMUSE00000607953 Chr17:35277178..35277434 CAAGGCTACCGTCTCTGAGG Chr17:35277261..35277280 60.01 60
downstream ENSMUSE00000607952 Chr17:35277767..35277896 ACCTCGCAGTAGCGCTGTAG Chr17:35277862..35277881 60.75 60
downstream ENSMUSE00000607951 Chr17:35278371..35278568 CACGAAAGTGTTGCCCAGTA Chr17:35278451..35278470 59.76 50
downstream ENSMUSE00000607950 Chr17:35278775..35279027 TGGTCACAGTAGTCCCCACA Chr17:35278802..35278821 60 55
downstream ENSMUSE00000607949 Chr17:35279252..35279329 GGTCTGTCCATGACCAGGAG Chr17:35279328..35279347 60.53 60
downstream ENSMUSE00000607928 Chr17:35279443..35279550 GCCTGATGAGTGATCTGGTG Chr17:35279521..35279540 59.21 55
downstream ENSMUSE00000657453 Chr17:35279672..35279784 GAGTTGGTGCTGTTGGGAAG Chr17:35279710..35279729 60.69 55
downstream ENSMUSE00000474183 Chr17:35279868..35279955 TCTGGGCCAATGAAGTGTTT Chr17:35279910..35279929 60.49 45
downstream ENSMUSE00000607926 Chr17:35279871..35279955 TCTGGGCCAATGAAGTGTTT Chr17:35279910..35279929 60.49 45
downstream ENSMUSE00000657452 Chr17:35280278..35280627 AAATCAGTCATGCCCTGGAG Chr17:35280623..35280642 60.07 50
downstream ENSMUSE00000657451 Chr17:35281096..35281387 TCTCAGGACCTAAGCCTCCA Chr17:35281228..35281247 59.94 55
downstream ENSMUSE00000657450 Chr17:35281544..35281713 GAGAGCAGAGCTCCGAAGAA Chr17:35281568..35281587 59.97 55
downstream ENSMUSE00000657449 Chr17:35281891..35281944 CATACTCTTCCAGCCCAGTGA Chr17:35281932..35281952 60.26 52.38
downstream ENSMUSE00000657448 Chr17:35282082..35282184 TCCGGATGATATCCACACCT Chr17:35282124..35282143 60.16 50
downstream ENSMUSE00000657447 Chr17:35282274..35282398 CCATTGATGACAGCAGCAAG Chr17:35282394..35282413 60.41 50
downstream ENSMUSE00000657446 Chr17:35282551..35282697 AGGATCACCAACCCTACGAA Chr17:35282694..35282713 59.4 50
downstream ENSMUSE00000657445 Chr17:35282807..35282866 TGAACTTCCATCGGCTCTTC Chr17:35282838..35282857 60.34 50
downstream ENSMUSE00000657444 Chr17:35282971..35283114 CTGTTCATCTCGGGAACCTC Chr17:35283069..35283088 59.65 55
downstream ENSMUSE00000714083 Chr17:35283191..35283298 ATGCCACTGAGGTAGGCATC Chr17:35283282..35283301 60.1 55
downstream ENSMUSE00000722169 Chr17:35283191..35283298 ATGCCACTGAGGTAGGCATC Chr17:35283282..35283301 60.1 55
downstream ENSMUSE00000141843 Chr17:35283702..35283848 GCTCTCCTGAACCTCTGGTG Chr17:35283839..35283858 59.99 60
downstream ENSMUSE00000697491 Chr17:35283702..35283848 GCTCTCCTGAACCTCTGGTG Chr17:35283839..35283858 59.99 60
downstream ENSMUSE00000544727 Chr17:35284086..35284181 GGGGCTGTAGTTGGGATCTT Chr17:35284139..35284158 60.33 55
downstream ENSMUSE00000697492 Chr17:35284086..35284250 AAAGCTAGGGGTCATCAGCA Chr17:35284188..35284207 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCGCCTGATTTTCTTGTC Chr17:35273208..35273228 60.22 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCGCCTGATTTTCTTGTC Chr17:35273208..35273228 60.22 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024392