Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26934
Trapped Gene
Hook3 (ENSMUSG00000037234)
Vector Insertion
Chr 8: 27206303 - 27221207
Public Clones IST10196G11 (tigm)
Private Clones OST84603 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251091 (Chr8:27221208..27221293 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTCATGTCCCAGGTTCTTC Chr8:27221215..27221235 59.96 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251091 (Chr8:27221208..27221293 -)
Downstram Exon
ENSMUSE00000449086 (Chr8:27206230..27206302 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTCATGTCCCAGGTTCTTC Chr8:27221215..27221235 59.96 47.62 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477146 Chr8:27229430..27229642 CTGGTTGGTTGAAGGGAGAC Chr8:27229507..27229526 59.55 55
upstream ENSMUSE00000251091 Chr8:27221208..27221293 TTGTCATGTCCCAGGTTCTTC Chr8:27221215..27221235 59.96 47.62

*** Putative Vector Insertion (Chr 8: 27206303 - 27221207) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000449086 Chr8:27206230..27206302 No primer for this exon
downstream ENSMUSE00000523228 Chr8:27204129..27204179 No primer for this exon
downstream ENSMUSE00000251159 Chr8:27198532..27198664 CAATGAGGTTCACGTCAGGA Chr8:27198591..27198610 59.68 50
downstream ENSMUSE00000251155 Chr8:27192986..27193053 TGTCATGACGACATGCTGAA Chr8:27192976..27192995 59.82 45
downstream ENSMUSE00000251149 Chr8:27185340..27185402 CATAGGCATCATGTCCAGCA Chr8:27185335..27185354 60.65 50
downstream ENSMUSE00000251139 Chr8:27184072..27184155 GGCATCTTTGAGCAATTTCC Chr8:27184067..27184086 59.65 45
downstream ENSMUSE00000464055 Chr8:27182729..27182892 GCTGGGCTATTGGGATCTTC Chr8:27182767..27182786 60.93 55
downstream ENSMUSE00000251242 Chr8:27181530..27181670 CAGCGGATTCGATAATCGTC Chr8:27181613..27181632 60.57 50
downstream ENSMUSE00000251236 Chr8:27180546..27180747 TCTCCAAGGTCTTCCAGCTT Chr8:27180651..27180670 59.01 50
downstream ENSMUSE00000251230 Chr8:27179031..27179141 No primer for this exon
downstream ENSMUSE00000251223 Chr8:27178322..27178409 CTGCACACAACGCAACTCTT Chr8:27178328..27178347 60.1 50
downstream ENSMUSE00000251083 Chr8:27171849..27171918 AATCTCTGCTGCAAGGCTGT Chr8:27171844..27171863 60.16 50
downstream ENSMUSE00000251075 Chr8:27169712..27169852 CTGTTCTCCGTCTCCAGCTC Chr8:27169690..27169709 60.13 60
downstream ENSMUSE00000251219 Chr8:27158724..27158811 TTTGAACCTTGATCCTGCAA Chr8:27158712..27158731 59.25 40
downstream ENSMUSE00000251213 Chr8:27154712..27154746 No primer for this exon
downstream ENSMUSE00000251207 Chr8:27150141..27150223 TGCAATTCATTGTTGGCTTC Chr8:27150169..27150188 59.67 40
downstream ENSMUSE00000251199 Chr8:27148494..27148594 TCTTCCGTAAAGCCTCTTGC Chr8:27148534..27148553 59.59 50
downstream ENSMUSE00000251193 Chr8:27145605..27145709 TTCTGGTGCTGCTCCTTGAT Chr8:27145640..27145659 60.94 50
downstream ENSMUSE00000251184 Chr8:27145403..27145474 No primer for this exon
downstream ENSMUSE00000523227 Chr8:27139381..27142502 TGGTGACAGGTCCTCCCTAC Chr8:27139414..27139433 59.96 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCAGTAATTGTGCCTTTC Chr8:27212163..27212183 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTGCCTTTCAGATGATCG Chr8:27212154..27212174 59.8 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr8:27215224..27215244 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGACCGTGACTGGGAAAAC Chr8:27215228..27215248 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037234