Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26940
Trapped Gene
Cenph (ENSMUSG00000045273)
Vector Insertion
Chr 13: 101536837 - 101541149
Public Clones not available
Private Clones OST83871 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610960 (Chr13:101541150..101541224 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610960 (Chr13:101541150..101541224 -)
Downstram Exon
ENSMUSE00000610959 (Chr13:101536780..101536836 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCCGAAGTGCAACTGAAAGT Chr13:101536789..101536808 60.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000461247 Chr13:101545642..101545838 AGGAACTTCCGGAAACCAAT Chr13:101545819..101545838 59.81 45
upstream ENSMUSE00000610962 Chr13:101542681..101542736 GCTCAGACAAAACAGCAGCTC Chr13:101542709..101542729 60.34 52.38
upstream ENSMUSE00000610961 Chr13:101541610..101541658 No primer for this exon
upstream ENSMUSE00000610960 Chr13:101541150..101541224 No primer for this exon

*** Putative Vector Insertion (Chr 13: 101536837 - 101541149) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000610959 Chr13:101536780..101536836 CCCGAAGTGCAACTGAAAGT Chr13:101536789..101536808 60.29 50
downstream ENSMUSE00000610958 Chr13:101534124..101534187 TGCTTCATGTCATCTGTGAGC Chr13:101534142..101534162 60.01 47.62
downstream ENSMUSE00000610957 Chr13:101533505..101533556 CATCAAGCAGCTTTTTCTCCA Chr13:101533501..101533521 60.51 42.86
downstream ENSMUSE00000494963 Chr13:101531716..101531879 TCTCCATCTTGTCAACATCCTC Chr13:101531774..101531795 59.14 45.46
downstream ENSMUSE00000508323 Chr13:101529641..101530149 AAACTGCGGGATTCTTCTCA Chr13:101530018..101530037 59.81 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCTTTAACAGTTCACGGTAGA Chr13:101538167..101538190 58.03 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045273