Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26942
Trapped Gene
Magmas (ENSMUSG00000014301)
Vector Insertion
Chr 16: 4616879 - 4617125
Public Clones not available
Private Clones OST83754 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000470644 (Chr16:4617126..4617262 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000470644 (Chr16:4617126..4617262 -)
Downstram Exon
ENSMUSE00000465823 (Chr16:4616813..4616878 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704393 Chr16:4624851..4624936 No primer for this exon
upstream ENSMUSE00000414559 Chr16:4617919..4618003 No primer for this exon
upstream ENSMUSE00000470644 Chr16:4617126..4617262 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4616879 - 4617125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465823 Chr16:4616813..4616878 No primer for this exon
downstream ENSMUSE00000294384 Chr16:4616474..4616633 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCAGAAGTAATCGCCTTG Chr16:4617063..4617083 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGCAGATTCTCAACGTC Chr16:4617154..4617174 60.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014301