Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26960
Trapped Gene
Mrpl22 (ENSMUSG00000020514)
Vector Insertion
Chr 11: 57986653 - 57988778
Public Clones CMHD-GT_490E3-3 (cmhd)
Private Clones OST82227 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388531 (Chr11:57986535..57986652 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388531 (Chr11:57986535..57986652 +)
Downstram Exon
ENSMUSE00000105563 (Chr11:57988779..57988844 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000393212 Chr11:57985163..57985215 No primer for this exon
upstream ENSMUSE00000349834 Chr11:57985296..57985344 No primer for this exon
upstream ENSMUSE00000388531 Chr11:57986535..57986652 No primer for this exon

*** Putative Vector Insertion (Chr 11: 57986653 - 57988778) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105563 Chr11:57988779..57988844 No primer for this exon
downstream ENSMUSE00000105567 Chr11:57989634..57989711 No primer for this exon
downstream ENSMUSE00000105566 Chr11:57990719..57990788 No primer for this exon
downstream ENSMUSE00000362555 Chr11:57992780..57993067 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTAATCGCCTTGCAGCAC Chr11:57986701..57986721 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAGCGGTAAGTTTGTAGGG Chr11:57986647..57986668 60.41 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020514