Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26966
Trapped Gene
Dctn2 (ENSMUSG00000025410)
Vector Insertion
Chr 10: 126703591 - 126704469
Public Clones not available
Private Clones OST81417 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000455534 (Chr10:126703455..126703590 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTAAATACGCCGATCTCC Chr10:126703563..126703582 60.78 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000455534 (Chr10:126703455..126703590 +)
Downstram Exon
ENSMUSE00000278783 (Chr10:126704470..126704538 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTAAATACGCCGATCTCC Chr10:126703563..126703582 60.78 55 CTCAGGTAGGTCGCTGGTTT Chr10:126704517..126704536 59.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455534 Chr10:126703455..126703590 CCCTAAATACGCCGATCTCC Chr10:126703563..126703582 60.78 55

*** Putative Vector Insertion (Chr 10: 126703591 - 126704469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000278783 Chr10:126704470..126704538 CTCAGGTAGGTCGCTGGTTT Chr10:126704517..126704536 59.35 55
downstream ENSMUSE00000278774 Chr10:126711770..126711866 TTGGGGTTGACAATGATGTG Chr10:126711819..126711838 60.22 45
downstream ENSMUSE00000150579 Chr10:126712050..126712111 TGGTCTTTCCAATGCGATCT Chr10:126712079..126712098 60.6 45
downstream ENSMUSE00000150581 Chr10:126712880..126712978 CCTTCACTCCCAGACCCTCT Chr10:126712907..126712926 60.64 60
downstream ENSMUSE00000150584 Chr10:126713440..126713600 No primer for this exon
downstream ENSMUSE00000150587 Chr10:126713758..126713905 TGGCAGCTTGAGAGAACTTG Chr10:126713906..126713925 59.31 50
downstream ENSMUSE00000150575 Chr10:126714311..126714376 AGACGCTTCTCGAGTTCTGC Chr10:126714336..126714355 59.9 55
downstream ENSMUSE00000150580 Chr10:126714543..126714581 TAAGGCAGGCTCCCTGTAGA Chr10:126714582..126714601 59.97 55
downstream ENSMUSE00000150573 Chr10:126714751..126714828 AAGCCGAGCCTCTACTTGGT Chr10:126714828..126714847 60.4 55
downstream ENSMUSE00000150578 Chr10:126714923..126714994 TCATTCACCTTTCCCAGGAC Chr10:126714948..126714967 59.9 50
downstream ENSMUSE00000150589 Chr10:126715176..126715278 GGTGACAAGTCGCTGTACCA Chr10:126715259..126715278 59.75 55
downstream ENSMUSE00000150586 Chr10:126715373..126715464 CTTAAGGGAACTGGCCATCA Chr10:126715443..126715462 60.07 50
downstream ENSMUSE00000361731 Chr10:126718457..126718862 GTACCCCACATGCAAGAACC Chr10:126718668..126718687 60.24 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCCTAAATACGCCGATCTC Chr10:126703562..126703583 59.94 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCCTAAATACGCCGATCTC Chr10:126703562..126703583 59.94 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025410