Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26967
Trapped Gene
Recql (ENSMUSG00000030243)
Vector Insertion
Chr 6: 142326871 - 142333048
Public Clones not available
Private Clones OST81364 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720250 (Chr6:142333049..142333096 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATTTGGATCTCCGGTTCAG Chr6:142333072..142333091 60.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720250 (Chr6:142333049..142333096 -)
Downstram Exon
ENSMUSE00000296975 (Chr6:142326673..142326870 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATTTGGATCTCCGGTTCAG Chr6:142333072..142333091 60.45 50 CTGGTGATGTGTCCAAGTCG Chr6:142326669..142326688 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689079 Chr6:142335542..142335607 No primer for this exon
upstream ENSMUSE00000689085 Chr6:142335542..142335556 No primer for this exon
upstream ENSMUSE00000720250 Chr6:142333049..142333096 CATTTGGATCTCCGGTTCAG Chr6:142333072..142333091 60.45 50
upstream ENSMUSE00000720639 Chr6:142333049..142333096 CATTTGGATCTCCGGTTCAG Chr6:142333072..142333091 60.45 50

*** Putative Vector Insertion (Chr 6: 142326871 - 142333048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296975 Chr6:142326673..142326870 CTGGTGATGTGTCCAAGTCG Chr6:142326669..142326688 60.15 55
downstream ENSMUSE00000689072 Chr6:142326673..142326870 CTGGTGATGTGTCCAAGTCG Chr6:142326669..142326688 60.15 55
downstream ENSMUSE00000196718 Chr6:142325301..142325480 TACCTTTCCGAACCATGGAA Chr6:142325436..142325455 60.3 45
downstream ENSMUSE00000689070 Chr6:142325301..142325480 TACCTTTCCGAACCATGGAA Chr6:142325436..142325455 60.3 45
downstream ENSMUSE00000196715 Chr6:142323340..142323446 AGATGAGTGGGCAAATCACA Chr6:142323395..142323414 59.09 45
downstream ENSMUSE00000689067 Chr6:142323340..142323446 AGATGAGTGGGCAAATCACA Chr6:142323395..142323414 59.09 45
downstream ENSMUSE00000196710 Chr6:142321336..142321534 CAGCAATGCACTTCATCCAC Chr6:142321343..142321362 60.27 50
downstream ENSMUSE00000689064 Chr6:142321336..142321534 CAGCAATGCACTTCATCCAC Chr6:142321343..142321362 60.27 50
downstream ENSMUSE00000196709 Chr6:142317811..142317977 GAAACTGGCGCTTCAAGATG Chr6:142317920..142317939 60.91 50
downstream ENSMUSE00000689057 Chr6:142317811..142317977 GAAACTGGCGCTTCAAGATG Chr6:142317920..142317939 60.91 50
downstream ENSMUSE00000196708 Chr6:142316993..142317074 CTTCAGCACTTGAGGGCTTT Chr6:142317025..142317044 59.62 50
downstream ENSMUSE00000689055 Chr6:142316993..142317074 CTTCAGCACTTGAGGGCTTT Chr6:142317025..142317044 59.62 50
downstream ENSMUSE00000196717 Chr6:142316001..142316149 CCTGCATGAATTCCCAACTT Chr6:142316052..142316071 59.93 45
downstream ENSMUSE00000689054 Chr6:142316001..142316149 CCTGCATGAATTCCCAACTT Chr6:142316052..142316071 59.93 45
downstream ENSMUSE00000196707 Chr6:142315794..142315911 CGCCCGCTCTCTTGATAGTA Chr6:142315777..142315796 60.5 55
downstream ENSMUSE00000689053 Chr6:142315794..142315911 CGCCCGCTCTCTTGATAGTA Chr6:142315777..142315796 60.5 55
downstream ENSMUSE00000196712 Chr6:142315187..142315325 CCCCAAAGCCGTAATACAGA Chr6:142315256..142315275 59.95 50
downstream ENSMUSE00000440296 Chr6:142315187..142315325 CCCCAAAGCCGTAATACAGA Chr6:142315256..142315275 59.95 50
downstream ENSMUSE00000650559 Chr6:142314036..142314127 TCTGCGTTCCACACTTCATC Chr6:142314055..142314074 59.84 50
downstream ENSMUSE00000650556 Chr6:142312956..142313175 TTTCCCATCCAAGCATCAAT Chr6:142313036..142313055 60.27 40
downstream ENSMUSE00000650552 Chr6:142312067..142312196 CTAACGCTGCTCTGTGCTGA Chr6:142312046..142312065 60.49 55
downstream ENSMUSE00000513853 Chr6:142311326..142311389 CACCTGACGAGCTTCAGACA Chr6:142311341..142311360 60.18 55
downstream ENSMUSE00000650539 Chr6:142310420..142311389 CTTTCATCATACGGGGAGGA Chr6:142310438..142310457 59.89 50
downstream ENSMUSE00000689051 Chr6:142308436..142308512 CGGGGCAGAGGTAGTGTTTA Chr6:142308450..142308469 60.12 55
downstream ENSMUSE00000689078 Chr6:142306531..142306574 GGGATCTGATGCTCTTGTCTG Chr6:142306526..142306546 59.82 52.38
downstream ENSMUSE00000650548 Chr6:142298862..142299065 TGAGGTCAGCATGTTTTCCA Chr6:142298880..142298899 60.24 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCAGAGCTGCCTTCTCCA Chr6:142327052..142327072 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCAGAGCTGCCTTCTCCA Chr6:142327052..142327072 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030243