Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26978
Trapped Gene
Mllt6 (ENSMUSG00000038437)
Vector Insertion
Chr 11: 97524995 - 97526268
Public Clones (sanger) D109G11 (ggtc) P151B04 (ggtc) D109G11 (ggtc) E078C04 (ggtc)
D021F09 (ggtc) IST14360D3 (tigm) IST13099H7 (tigm) IST13124H12 (tigm)
IST13095H11 (tigm) IST14289F2 (tigm) IST13105H1 (tigm) IST12843H9 (tigm)
Private Clones OST80964 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000380979 (Chr11:97524726..97524994 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAACCCGCTGGTCTACTG Chr11:97524940..97524959 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000380979 (Chr11:97524726..97524994 +)
Downstram Exon
ENSMUSE00000335074 (Chr11:97526269..97526348 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAACCCGCTGGTCTACTG Chr11:97524940..97524959 59.73 55 TCACATTTCCTGCAGAACCA Chr11:97526326..97526345 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000380979 Chr11:97524726..97524994 GAAAACCCGCTGGTCTACTG Chr11:97524940..97524959 59.73 55

*** Putative Vector Insertion (Chr 11: 97524995 - 97526268) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335074 Chr11:97526269..97526348 TCACATTTCCTGCAGAACCA Chr11:97526326..97526345 60.24 45
downstream ENSMUSE00000286009 Chr11:97526800..97526854 CTTCAATGCCCCATCTTTGT Chr11:97526841..97526860 59.93 45
downstream ENSMUSE00000286000 Chr11:97527044..97527153 TTGTTGAAGCGATCATGAGG Chr11:97527155..97527174 59.8 45
downstream ENSMUSE00000285992 Chr11:97528104..97528207 GCCCTGTTCCTCACAGATGTA Chr11:97528132..97528152 60.13 52.38
downstream ENSMUSE00000285987 Chr11:97528389..97528482 TTGTCCACCTCCAGGACTTC Chr11:97528442..97528461 60.09 55
downstream ENSMUSE00000285975 Chr11:97530738..97530950 ATGGTGGGTAGGGTGCTTCT Chr11:97530935..97530954 60.77 55
downstream ENSMUSE00000285967 Chr11:97531567..97531665 GCGTTCTTTGTCCTTTCGAC Chr11:97531590..97531609 59.86 50
downstream ENSMUSE00000285958 Chr11:97533771..97533906 GAGGAAGAAGTCGCTGAGGA Chr11:97533796..97533815 59.68 55
downstream ENSMUSE00000673758 Chr11:97533771..97533996 GAGGAAGAAGTCGCTGAGGA Chr11:97533796..97533815 59.68 55
downstream ENSMUSE00000285949 Chr11:97534774..97535385 CCCGGTAATATGGGGAGACT Chr11:97535042..97535061 60.03 55
downstream ENSMUSE00000285944 Chr11:97535752..97535933 GGAAGCAGAAGAGGATGCAA Chr11:97535921..97535940 60.48 50
downstream ENSMUSE00000285939 Chr11:97536088..97536196 TGAGGAGGGGGTTAACAGTG Chr11:97536175..97536194 59.96 55
downstream ENSMUSE00000285928 Chr11:97537453..97537519 No primer for this exon
downstream ENSMUSE00000285919 Chr11:97537684..97537826 AGCTGCTCCATGTTGGTTGT Chr11:97537791..97537810 60.72 50
downstream ENSMUSE00000285912 Chr11:97538176..97538373 TTCGCTGTCAGGCTAAGGAT Chr11:97538260..97538279 59.98 50
downstream ENSMUSE00000285904 Chr11:97538462..97538550 GAGGTGGACAGGGAATTGTC Chr11:97538546..97538565 59.36 55
downstream ENSMUSE00000285893 Chr11:97539628..97539977 CTGTGGAAGGAGAGCGAAGA Chr11:97539683..97539702 60.67 55
downstream ENSMUSE00000285881 Chr11:97540279..97540369 GCTGAAGGAGGTGTCTCTGC Chr11:97540313..97540332 60.14 60
downstream ENSMUSE00000285873 Chr11:97541784..97542140 CTTGTATTGCTGCCCAGTGA Chr11:97542013..97542032 59.86 50
downstream ENSMUSE00000375518 Chr11:97542860..97546757 CAGGAGCTTGAGAGGGACAC Chr11:97546012..97546031 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:97525046..97525066 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000038437