Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26983
Trapped Gene
Tep1 (ENSMUSG00000006281)
Vector Insertion
Chr 14: 51488261 - 51490087
Public Clones not available
Private Clones OST80282 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000560242 (Chr14:51490088..51490235 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000560242 (Chr14:51490088..51490235 -)
Downstram Exon
ENSMUSE00000378468 (Chr14:51487670..51488260 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000560242 Chr14:51490088..51490235 No primer for this exon

*** Putative Vector Insertion (Chr 14: 51488261 - 51490087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378468 Chr14:51487670..51488260 No primer for this exon
downstream ENSMUSE00000408967 Chr14:51486364..51486543 No primer for this exon
downstream ENSMUSE00000367812 Chr14:51485625..51485759 No primer for this exon
downstream ENSMUSE00000291112 Chr14:51483177..51483338 No primer for this exon
downstream ENSMUSE00000291106 Chr14:51482529..51482690 No primer for this exon
downstream ENSMUSE00000291095 Chr14:51482158..51482235 No primer for this exon
downstream ENSMUSE00000291090 Chr14:51480599..51480723 No primer for this exon
downstream ENSMUSE00000291081 Chr14:51480253..51480410 No primer for this exon
downstream ENSMUSE00000386933 Chr14:51475265..51475374 No primer for this exon
downstream ENSMUSE00000336074 Chr14:51474184..51474274 No primer for this exon
downstream ENSMUSE00000379054 Chr14:51473803..51473989 No primer for this exon
downstream ENSMUSE00000121479 Chr14:51473225..51473393 No primer for this exon
downstream ENSMUSE00000121438 Chr14:51472652..51472810 No primer for this exon
downstream ENSMUSE00000291213 Chr14:51471597..51471674 No primer for this exon
downstream ENSMUSE00000366253 Chr14:51470262..51470392 No primer for this exon
downstream ENSMUSE00000399146 Chr14:51469709..51469768 No primer for this exon
downstream ENSMUSE00000358448 Chr14:51467289..51467447 No primer for this exon
downstream ENSMUSE00000388233 Chr14:51466508..51466684 No primer for this exon
downstream ENSMUSE00000347765 Chr14:51466150..51466270 No primer for this exon
downstream ENSMUSE00000121497 Chr14:51465091..51465215 No primer for this exon
downstream ENSMUSE00000121432 Chr14:51464735..51464848 No primer for this exon
downstream ENSMUSE00000560228 Chr14:51464527..51464644 No primer for this exon
downstream ENSMUSE00000560227 Chr14:51464209..51464403 No primer for this exon
downstream ENSMUSE00000560226 Chr14:51463930..51464105 No primer for this exon
downstream ENSMUSE00000420380 Chr14:51463698..51463854 No primer for this exon
downstream ENSMUSE00000420369 Chr14:51463381..51463560 No primer for this exon
downstream ENSMUSE00000420366 Chr14:51462852..51462944 No primer for this exon
downstream ENSMUSE00000420372 Chr14:51461540..51461672 No primer for this exon
downstream ENSMUSE00000560222 Chr14:51461232..51461382 No primer for this exon
downstream ENSMUSE00000560221 Chr14:51460885..51461018 No primer for this exon
downstream ENSMUSE00000560220 Chr14:51460644..51460732 No primer for this exon
downstream ENSMUSE00000560219 Chr14:51460257..51460371 No primer for this exon
downstream ENSMUSE00000399105 Chr14:51458621..51458861 No primer for this exon
downstream ENSMUSE00000121472 Chr14:51458199..51458316 No primer for this exon
downstream ENSMUSE00000121456 Chr14:51457259..51457383 No primer for this exon
downstream ENSMUSE00000121435 Chr14:51457055..51457154 No primer for this exon
downstream ENSMUSE00000291392 Chr14:51456713..51456868 No primer for this exon
downstream ENSMUSE00000291387 Chr14:51456360..51456572 No primer for this exon
downstream ENSMUSE00000121486 Chr14:51455985..51456138 No primer for this exon
downstream ENSMUSE00000121484 Chr14:51455667..51455879 No primer for this exon
downstream ENSMUSE00000121474 Chr14:51453589..51453752 No primer for this exon
downstream ENSMUSE00000121443 Chr14:51453129..51453242 No primer for this exon
downstream ENSMUSE00000121436 Chr14:51451407..51451514 No primer for this exon
downstream ENSMUSE00000121439 Chr14:51449805..51449937 No primer for this exon
downstream ENSMUSE00000121434 Chr14:51449547..51449623 No primer for this exon
downstream ENSMUSE00000121454 Chr14:51449338..51449467 No primer for this exon
downstream ENSMUSE00000121433 Chr14:51448843..51448979 No primer for this exon
downstream ENSMUSE00000121440 Chr14:51448580..51448704 No primer for this exon
downstream ENSMUSE00000121477 Chr14:51446731..51446874 No primer for this exon
downstream ENSMUSE00000121451 Chr14:51446488..51446584 No primer for this exon
downstream ENSMUSE00000121458 Chr14:51444731..51444836 No primer for this exon
downstream ENSMUSE00000121442 Chr14:51444407..51444624 No primer for this exon
downstream ENSMUSE00000121495 Chr14:51444180..51444284 No primer for this exon
downstream ENSMUSE00000402508 Chr14:51443737..51443965 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCCCGGAAGGACCTCTTA Chr14:51490034..51490054 60.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGGACCTCTCGTGACTG Chr14:51490028..51490048 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006281