Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26986
Trapped Gene
Adrbk2 (ENSMUSG00000042249)
Vector Insertion
Chr 5: 113384276 - 113386334
Public Clones not available
Private Clones OST80112 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275403 (Chr5:113386335..113386386 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCAGTGGAAGAACGTGGA Chr5:113386348..113386367 60.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275403 (Chr5:113386335..113386386 -)
Downstram Exon
ENSMUSE00000485235 (Chr5:113384184..113384275 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCAGTGGAAGAACGTGGA Chr5:113386348..113386367 60.28 50 CAGCCATAAACTTCCCCAAA Chr5:113384186..113384205 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000540101 Chr5:113444387..113444534 GCCATGGAGAAGAGCAAGAC Chr5:113444435..113444454 59.96 55
upstream ENSMUSE00000540100 Chr5:113414785..113414861 TATCCGGAGTGTGATGCAGA Chr5:113414842..113414861 60.22 50
upstream ENSMUSE00000495495 Chr5:113402527..113402600 AGCAGTGCCTCAGGTGAAAT Chr5:113402538..113402557 59.87 50
upstream ENSMUSE00000275425 Chr5:113398188..113398289 AAGCTGGACAACGAAGAGGA Chr5:113398255..113398274 59.99 50
upstream ENSMUSE00000275418 Chr5:113395932..113396006 GGTGACGGCTACACTTTTCC Chr5:113395934..113395953 59.6 55
upstream ENSMUSE00000483275 Chr5:113390607..113390668 CTTCGTGGGGATATTTTCCA Chr5:113390622..113390641 59.76 45
upstream ENSMUSE00000275403 Chr5:113386335..113386386 TGTCAGTGGAAGAACGTGGA Chr5:113386348..113386367 60.28 50

*** Putative Vector Insertion (Chr 5: 113384276 - 113386334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000485235 Chr5:113384184..113384275 CAGCCATAAACTTCCCCAAA Chr5:113384186..113384205 59.93 45
downstream ENSMUSE00000486061 Chr5:113382846..113382945 CAGCATGATCCTCTCGTTCA Chr5:113382842..113382861 59.94 50
downstream ENSMUSE00000487155 Chr5:113375607..113375685 GTGTGGAAGGCGTAGGTCAT Chr5:113375623..113375642 60 55
downstream ENSMUSE00000540098 Chr5:113373938..113374068 AGAAAACACCCCGTGTTGAG Chr5:113374003..113374022 60.01 50
downstream ENSMUSE00000540097 Chr5:113370653..113370747 CCGAGATCCGATATCCTCAC Chr5:113370673..113370692 59.46 55
downstream ENSMUSE00000275370 Chr5:113366729..113366836 CTGCTGTCATAGCACGTTCC Chr5:113366755..113366774 59.47 55
downstream ENSMUSE00000275364 Chr5:113358693..113358759 GGTCAGGGTCATTCGGTCTA Chr5:113358674..113358693 59.93 55
downstream ENSMUSE00000275357 Chr5:113357676..113357776 GAGAAGGCATCTGGAAGCTG Chr5:113357729..113357748 60.1 55
downstream ENSMUSE00000275351 Chr5:113354416..113354482 GATGTGCTCCTTCAACTCTCG Chr5:113354436..113354456 60.01 52.38
downstream ENSMUSE00000275343 Chr5:113352969..113353064 ATCTGCAGCGTTGACCTCTC Chr5:113352995..113353014 60.56 55
downstream ENSMUSE00000275337 Chr5:113349028..113349190 CCTGGCCTCGATTTTATCAG Chr5:113349043..113349062 59.66 50
downstream ENSMUSE00000540093 Chr5:113347846..113347982 CAGTCCTTCCCCATAGCGTA Chr5:113347939..113347958 60.09 55
downstream ENSMUSE00000595230 Chr5:113345070..113345183 TCTGGGTCTCCTCCACAGAC Chr5:113345113..113345132 60.24 60
downstream ENSMUSE00000595229 Chr5:113339498..113344094 TCTGGCGTGATTTAGTGCAG Chr5:113342174..113342193 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000042249