Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2699
Trapped Gene
Pknox1 (ENSMUSG00000006705)
Vector Insertion
Chr 17: 31720749 - 31725404
Public Clones AL0235 (sanger) (ggtc) E057E10 (ggtc) E055B06 (ggtc) IST14968B7 (tigm)
IST14277G1 (tigm) IST10909C3 (tigm) IST12011E9 (tigm) IST14136F5 (tigm)
Private Clones OST383188 (lexicon) OST333747 (lexicon) OST254038 (lexicon) OST197882 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657742 (Chr17:31720641..31720748 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657742 (Chr17:31720641..31720748 +)
Downstram Exon
ENSMUSE00000137438 (Chr17:31725405..31725532 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657743 Chr17:31701746..31701833 No primer for this exon
upstream ENSMUSE00000657742 Chr17:31720641..31720748 No primer for this exon

*** Putative Vector Insertion (Chr 17: 31720749 - 31725404) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137438 Chr17:31725405..31725532 No primer for this exon
downstream ENSMUSE00000137439 Chr17:31727548..31727719 No primer for this exon
downstream ENSMUSE00000137432 Chr17:31729050..31729220 No primer for this exon
downstream ENSMUSE00000137440 Chr17:31732170..31732269 No primer for this exon
downstream ENSMUSE00000137435 Chr17:31733741..31733838 No primer for this exon
downstream ENSMUSE00000137433 Chr17:31736460..31736588 No primer for this exon
downstream ENSMUSE00000137441 Chr17:31739731..31739807 No primer for this exon
downstream ENSMUSE00000137436 Chr17:31740132..31740304 No primer for this exon
downstream ENSMUSE00000657741 Chr17:31741698..31742991 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr17:31720799..31720819 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACGTGACTGGGAAAACC Chr17:31720796..31720816 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006705