Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26994
Trapped Gene
Ftsj1 (ENSMUSG00000031171)
Vector Insertion
Chr X: 7827613 - 7827694
Public Clones not available
Private Clones OST79737 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000239653 (ChrX:7827695..7827764 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000239653 (ChrX:7827695..7827764 -)
Downstram Exon
ENSMUSE00000207056 (ChrX:7827522..7827612 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGAGTGATGTCGCCCTGTA ChrX:7827500..7827519 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000383729 ChrX:7829298..7829532 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000703517 ChrX:7829298..7829436 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000703521 ChrX:7829298..7829521 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000239660 ChrX:7828006..7828163 ACTGAGATGGGACGGACATC ChrX:7828113..7828132 59.93 55
upstream ENSMUSE00000239653 ChrX:7827695..7827764 No primer for this exon

*** Putative Vector Insertion (Chr X: 7827613 - 7827694) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207056 ChrX:7827522..7827612 CTGAGTGATGTCGCCCTGTA ChrX:7827500..7827519 59.85 55
downstream ENSMUSE00000239642 ChrX:7826105..7826183 GAGCCCCGTCACACACTACT ChrX:7826089..7826108 60.18 60
downstream ENSMUSE00000207055 ChrX:7823995..7824047 CATCCACATCATGGAGACCA ChrX:7824002..7824021 60.34 50
downstream ENSMUSE00000207066 ChrX:7823853..7823906 GCCCCCTAGCTTCAAGACAT ChrX:7823846..7823865 60.6 55
downstream ENSMUSE00000207064 ChrX:7823658..7823760 CTAGAGTTCCGGCTGCTCTT ChrX:7823641..7823660 58.84 55
downstream ENSMUSE00000207063 ChrX:7823462..7823545 GGTCAGGTCTGGAATGAAGC ChrX:7823465..7823484 59.66 55
downstream ENSMUSE00000207062 ChrX:7822678..7822781 GAGTAAGTGCGGTCCGAATC ChrX:7822663..7822682 59.7 55
downstream ENSMUSE00000703520 ChrX:7822678..7822775 GAGTAAGTGCGGTCCGAATC ChrX:7822663..7822682 59.7 55
downstream ENSMUSE00000343131 ChrX:7822410..7822598 TGTTGATGGAGCATTCTTGG ChrX:7822441..7822460 59.65 45
downstream ENSMUSE00000703516 ChrX:7822410..7822556 TGTTGATGGAGCATTCTTGG ChrX:7822441..7822460 59.65 45
downstream ENSMUSE00000207058 ChrX:7822186..7822227 No primer for this exon
downstream ENSMUSE00000703519 ChrX:7817546..7817956 GAATTCCTGGGCCTTCTAGG ChrX:7817674..7817693 60.03 55
downstream ENSMUSE00000422171 ChrX:7815794..7817956 TTCAGGCATTTCTTGCTCCT ChrX:7815786..7815805 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAGAAGGTTGGGTGAGT ChrX:7827687..7827707 61.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCAGAAGGTTGGGTGAGT ChrX:7827687..7827707 61.08 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031171