Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2700
Trapped Gene
Ncapd2 (ENSMUSG00000038252)
Vector Insertion
Chr 6: 125121966 - 125123007
Public Clones AL0224 (sanger) IST10492F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000243815 (Chr6:125123008..125123180 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGAACAAGCAGTGAGTGG Chr6:125123075..125123094 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000243815 (Chr6:125123008..125123180 -)
Downstram Exon
ENSMUSE00000243811 (Chr6:125121851..125121965 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGAACAAGCAGTGAGTGG Chr6:125123075..125123094 59.87 50 TCACAGATGCTTCGGATGAG Chr6:125121846..125121865 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341330 Chr6:125141516..125141613 GCGTATCCTGCCCTATTGTT Chr6:125141587..125141606 59.07 50
upstream ENSMUSE00000401504 Chr6:125139781..125139926 TGCTGAAAAGTGGAGGTGTG Chr6:125139839..125139858 59.87 50
upstream ENSMUSE00000243668 Chr6:125137095..125137170 CTCGCCATACTGGAGCACTT Chr6:125137119..125137138 60.42 55
upstream ENSMUSE00000243660 Chr6:125136772..125136830 AACCTGGCCTCAAGGAAGAC Chr6:125136794..125136813 60.63 55
upstream ENSMUSE00000243656 Chr6:125136118..125136299 AGGAACTGTCGTCCATCCTG Chr6:125136262..125136281 60.11 55
upstream ENSMUSE00000243650 Chr6:125135712..125135854 GCTGGACATCCGTCACCTAT Chr6:125135746..125135765 59.96 55
upstream ENSMUSE00000243641 Chr6:125134453..125134580 GCTACCGCCTTTTGGAGAAT Chr6:125134544..125134563 60.58 50
upstream ENSMUSE00000337778 Chr6:125134247..125134370 GTGACAGCCGTGAGTCTGTG Chr6:125134292..125134311 60.53 60
upstream ENSMUSE00000243905 Chr6:125133932..125134079 TGAGCTAGCAGAGCGAATCC Chr6:125133985..125134004 60.79 55
upstream ENSMUSE00000243897 Chr6:125130997..125131194 GGTGACCAGCTCGAAGAATC Chr6:125131112..125131131 59.81 55
upstream ENSMUSE00000243889 Chr6:125129713..125129847 GGCCAGCTTTCTAGCCAATA Chr6:125129730..125129749 59.46 50
upstream ENSMUSE00000243881 Chr6:125129531..125129618 ATTGACCTTGCTGGACCACT Chr6:125129590..125129609 59.58 50
upstream ENSMUSE00000243873 Chr6:125129256..125129430 TGTTGCCAGAATTGAAGTCG Chr6:125129375..125129394 59.84 45
upstream ENSMUSE00000243864 Chr6:125127827..125127942 CACTCGGGAAGCTACCAGTC Chr6:125127908..125127927 59.87 60
upstream ENSMUSE00000243856 Chr6:125127346..125127570 GGGCTGACAGGCAGTAAAGA Chr6:125127507..125127526 60.4 55
upstream ENSMUSE00000243850 Chr6:125126670..125126844 CTTAATGCGTACCGCCAACT Chr6:125126700..125126719 60.15 50
upstream ENSMUSE00000243843 Chr6:125126161..125126245 TCGCTGTTGTTAGTGGATGC Chr6:125126195..125126214 59.87 50
upstream ENSMUSE00000243838 Chr6:125124243..125124376 GAGCGCTGCTCCTCTGTTAT Chr6:125124264..125124283 59.75 55
upstream ENSMUSE00000243831 Chr6:125123798..125123930 AACATCTCGGACAGGAGGAA Chr6:125123799..125123818 59.65 50
upstream ENSMUSE00000243826 Chr6:125123619..125123703 CAGGAGCACAGGTTGTTTGA Chr6:125123645..125123664 59.87 50
upstream ENSMUSE00000243820 Chr6:125123378..125123542 AGAGCCCTGATGTGCTCTGT Chr6:125123451..125123470 60.02 55
upstream ENSMUSE00000243815 Chr6:125123008..125123180 TTGGAACAAGCAGTGAGTGG Chr6:125123075..125123094 59.87 50

*** Putative Vector Insertion (Chr 6: 125121966 - 125123007) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000243811 Chr6:125121851..125121965 TCACAGATGCTTCGGATGAG Chr6:125121846..125121865 59.94 50
downstream ENSMUSE00000243807 Chr6:125121654..125121777 TTGCTGTATAAGCCAGGGTTG Chr6:125121686..125121706 60.14 47.62
downstream ENSMUSE00000243800 Chr6:125121416..125121571 AGGTTAGGGAAGCGGATAGC Chr6:125121427..125121446 59.71 55
downstream ENSMUSE00000243794 Chr6:125120934..125121111 TGTCTTCCGCACTTGTTGAG Chr6:125121056..125121075 60.03 50
downstream ENSMUSE00000243787 Chr6:125120745..125120839 TCTGACAGGCGACTGATGAT Chr6:125120768..125120787 59.37 50
downstream ENSMUSE00000243779 Chr6:125120152..125120232 ACCGCTGACACAGCTTTTCT Chr6:125120143..125120162 60.06 50
downstream ENSMUSE00000243771 Chr6:125119833..125120016 ATCGCCAAAGCACTCAAAGT Chr6:125119892..125119911 59.88 45
downstream ENSMUSE00000243761 Chr6:125118881..125119007 ATCCATGCCTCTGGTGTGAC Chr6:125118929..125118948 60.97 55
downstream ENSMUSE00000243752 Chr6:125118608..125118766 ACGACCAGGTTTGGTACGTC Chr6:125118662..125118681 59.89 55
downstream ENSMUSE00000691073 Chr6:125118287..125118337 GGGTGGTTCTCTTGGGTGTC Chr6:125118268..125118287 61.75 60
downstream ENSMUSE00000691072 Chr6:125118106..125118176 GGCCATTTCCATGTTAAAACC Chr6:125118108..125118128 60.41 42.86
downstream ENSMUSE00000385544 Chr6:125118027..125118337 GAAAACAGCAATTGGCACAG Chr6:125118033..125118052 59.32 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCACTTCCTTCTTTCCAT Chr6:125122970..125122990 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCACTTCCTTCTTTCCAT Chr6:125122970..125122990 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGACTTGGCTCTTTTCCTT Chr6:125123192..125123212 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGACTTGGCTCTTTTCCTT Chr6:125123192..125123212 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038252