Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27002
Trapped Gene
Gdf15 (ENSMUSG00000038508)
Vector Insertion
Chr 8: 73154074 - 73155231
Public Clones not available
Private Clones OST79475 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682771 (Chr8:73155232..73155523 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTCCGGATACTCAGTCC Chr8:73155237..73155256 59.69 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682771 (Chr8:73155232..73155523 -)
Downstram Exon
ENSMUSE00000475963 (Chr8:73153293..73154073 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTCCGGATACTCAGTCC Chr8:73155237..73155256 59.69 60 TTCAGGGGCCTAGTGATGTC Chr8:73153907..73153926 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682772 Chr8:73156049..73156355 CGTGTGAGCATCCAGTCATC Chr8:73156056..73156075 60.28 55
upstream ENSMUSE00000213757 Chr8:73155232..73155994 CCGAGAGGACTCGAACTCAG Chr8:73155274..73155293 60.13 60
upstream ENSMUSE00000682771 Chr8:73155232..73155523 GCTGTCCGGATACTCAGTCC Chr8:73155237..73155256 59.69 60

*** Putative Vector Insertion (Chr 8: 73154074 - 73155231) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000475963 Chr8:73153293..73154073 TTCAGGGGCCTAGTGATGTC Chr8:73153907..73153926 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000038508