Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27012
Trapped Gene
Cib2 (ENSMUSG00000037493)
Vector Insertion
Chr 9: 54397700 - 54402293
Public Clones not available
Private Clones OST78916 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269312 (Chr9:54402294..54402328 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269312 (Chr9:54402294..54402328 -)
Downstram Exon
ENSMUSE00000269279 (Chr9:54397588..54397699 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTTGGGAGCCAGCTCATAGA Chr9:54397644..54397663 60.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636858 Chr9:54407775..54407994 GGGAACAAGCAGACCATCTT Chr9:54407803..54407822 59.14 50
upstream ENSMUSE00000269312 Chr9:54402294..54402328 No primer for this exon

*** Putative Vector Insertion (Chr 9: 54397700 - 54402293) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000269279 Chr9:54397588..54397699 GTTGGGAGCCAGCTCATAGA Chr9:54397644..54397663 60.36 55
downstream ENSMUSE00000269256 Chr9:54396140..54396287 CTGATTCGCAGAGCACAGAG Chr9:54396160..54396179 59.88 55
downstream ENSMUSE00000269240 Chr9:54393696..54393891 TCCAGGTCAGCCTCTTCAAT Chr9:54393740..54393759 59.8 50
downstream ENSMUSE00000699035 Chr9:54392603..54393291 TGGCAGTGTCTTCAGATTCG Chr9:54393237..54393256 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGCAGGTGGTTAAGACA Chr9:54402311..54402331 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGCAGGTGGTTAAGACA Chr9:54402311..54402331 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037493