Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27013
Trapped Gene
Dapp1 (ENSMUSG00000028159)
Vector Insertion
Chr 3: 137612742 - 137624405
Public Clones CMHD-GT_510C5-3 (cmhd)
Private Clones OST78808 (lexicon) OST68234 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176859 (Chr3:137624406..137624539 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTTGATTGGAAGCGAGAC Chr3:137624408..137624427 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176859 (Chr3:137624406..137624539 -)
Downstram Exon
ENSMUSE00000176861 (Chr3:137612611..137612741 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTTGATTGGAAGCGAGAC Chr3:137624408..137624427 59.81 50 GAACCCGGACTGATTCGTAA Chr3:137612645..137612664 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635672 Chr3:137644283..137644481 AGGAACTTATGGGCAGAGCA Chr3:137644372..137644391 59.84 50
upstream ENSMUSE00000176860 Chr3:137628845..137628967 TCCAATGGACGTGATGGTAG Chr3:137628899..137628918 59.37 50
upstream ENSMUSE00000176859 Chr3:137624406..137624539 CCTTTGATTGGAAGCGAGAC Chr3:137624408..137624427 59.81 50

*** Putative Vector Insertion (Chr 3: 137612742 - 137624405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176861 Chr3:137612611..137612741 GAACCCGGACTGATTCGTAA Chr3:137612645..137612664 59.93 50
downstream ENSMUSE00000176862 Chr3:137603825..137603872 TGGTGAGATAGCCTTCTTTGG Chr3:137603823..137603843 59.32 47.62
downstream ENSMUSE00000176863 Chr3:137602101..137602163 No primer for this exon
downstream ENSMUSE00000176858 Chr3:137600701..137600786 GATCCGAATTGGTTCTGGTG Chr3:137600744..137600763 60.32 50
downstream ENSMUSE00000176856 Chr3:137598546..137598633 ATCCATTCATCGGCTTCAAC Chr3:137598546..137598565 59.9 45
downstream ENSMUSE00000392006 Chr3:137595652..137596153 TTTCCATGGATCAGCAGACA Chr3:137595915..137595934 60.2 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCAGCCTTTGATTGGAAGC Chr3:137621411..137621431 59.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCAGCCTTTGATTGGAAGC Chr3:137621411..137621431 59.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028159