Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27021
Trapped Gene
Efhd1 (ENSMUSG00000026255)
Vector Insertion
Chr 1: 89161330 - 89186042
Public Clones not available
Private Clones OST77927 (lexicon) OST74971 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362543 (Chr1:89160938..89161329 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGAACTGAACCTCAAGC Chr1:89161183..89161202 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362543 (Chr1:89160938..89161329 +)
Downstram Exon
ENSMUSE00000542252 (Chr1:89186043..89186190 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGAACTGAACCTCAAGC Chr1:89161183..89161202 59.99 55 AATAAAGCCGTCCCTTCCAG Chr1:89186073..89186092 60.44 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362543 Chr1:89160938..89161329 CTCCGAACTGAACCTCAAGC Chr1:89161183..89161202 59.99 55
upstream ENSMUSE00000709822 Chr1:89160938..89161329 CTCCGAACTGAACCTCAAGC Chr1:89161183..89161202 59.99 55

*** Putative Vector Insertion (Chr 1: 89161330 - 89186042) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000542252 Chr1:89186043..89186190 AATAAAGCCGTCCCTTCCAG Chr1:89186073..89186092 60.44 50
downstream ENSMUSE00000542251 Chr1:89194204..89194338 ACTGTCCTCCTGCAGCTCAC Chr1:89194257..89194276 60.62 60
downstream ENSMUSE00000475023 Chr1:89206236..89207413 TCACACTAGCGTGGAAGACG Chr1:89206830..89206849 60.05 55
downstream ENSMUSE00000716727 Chr1:89206236..89206421 CCAGGGTGTTAGTAAGGCACA Chr1:89206421..89206441 60.04 52.38
downstream ENSMUSE00000711748 Chr1:89206547..89207411 TCACACTAGCGTGGAAGACG Chr1:89206830..89206849 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCAGGAACTTCGTCCTGT Chr1:89164313..89164333 60.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGCAGGCACCTGAAGAT Chr1:89164314..89164334 60.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026255