Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27030
Trapped Gene
Usf1 (ENSMUSG00000026641)
Vector Insertion
Chr 1: 173345686 - 173345845
Public Clones not available
Private Clones OST77580 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000299178 (Chr1:173345636..173345685 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACAGCTGAAACCGAAGAGG Chr1:173345645..173345664 59.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000299178 (Chr1:173345636..173345685 +)
Downstram Exon
ENSMUSE00000161459 (Chr1:173345846..173345961 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACAGCTGAAACCGAAGAGG Chr1:173345645..173345664 59.47 50 GGAAAAGTGGCAGCTGACTG Chr1:173345918..173345937 60.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000425361 Chr1:173341515..173341571 No primer for this exon
upstream ENSMUSE00000299186 Chr1:173344568..173344660 GAGCCCCCTCACAGAGAGAT Chr1:173344635..173344654 60.76 60
upstream ENSMUSE00000299178 Chr1:173345636..173345685 AACAGCTGAAACCGAAGAGG Chr1:173345645..173345664 59.47 50

*** Putative Vector Insertion (Chr 1: 173345686 - 173345845) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000161459 Chr1:173345846..173345961 GGAAAAGTGGCAGCTGACTG Chr1:173345918..173345937 60.97 55
downstream ENSMUSE00000161448 Chr1:173346266..173346367 CCCTCTGACACCTGGATCAC Chr1:173346300..173346319 60.53 60
downstream ENSMUSE00000161449 Chr1:173346941..173347136 CAGATGTGGTACCCCCTGAC Chr1:173347067..173347086 60.24 60
downstream ENSMUSE00000161450 Chr1:173347373..173347460 TCCCTCCCTGCAATACTTCTT Chr1:173347422..173347442 60.08 47.62
downstream ENSMUSE00000161453 Chr1:173347604..173347662 TTATGTTGAGCCCTCCGTTT Chr1:173347660..173347679 59.57 45
downstream ENSMUSE00000161458 Chr1:173347772..173347995 CCAGACTTGGTGCTCTCCAT Chr1:173347865..173347884 60.26 55
downstream ENSMUSE00000658694 Chr1:173348163..173348252 GGAGCAGGTTCTTGTTCTTGA Chr1:173348195..173348215 59.46 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAACCGAAGAGGGAACAG Chr1:173345652..173345672 60.22 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAACCGAAGAGGGAACAG Chr1:173345652..173345672 60.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026641