Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27033
Trapped Gene
G430022H21Rik (ENSMUSG00000028114)
Vector Insertion
Chr 3: 123086603 - 123088679
Public Clones not available
Private Clones OST77282 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261154 (Chr3:123088680..123088866 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAAAGTCTCCGGGTCAGA Chr3:123088847..123088866 60.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261154 (Chr3:123088680..123088866 -)
Downstram Exon
ENSMUSE00000176349 (Chr3:123086514..123086602 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAAAGTCTCCGGGTCAGA Chr3:123088847..123088866 60.24 55 CAATGCTATCCGCACTCTCA Chr3:123086553..123086572 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000261154 Chr3:123088680..123088866 GTGAAAGTCTCCGGGTCAGA Chr3:123088847..123088866 60.24 55

*** Putative Vector Insertion (Chr 3: 123086603 - 123088679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176349 Chr3:123086514..123086602 CAATGCTATCCGCACTCTCA Chr3:123086553..123086572 59.97 50
downstream ENSMUSE00000176352 Chr3:123085673..123085760 CCGTTTTGAGTTTGGAGCAG Chr3:123085702..123085721 60.8 50
downstream ENSMUSE00000176356 Chr3:123083566..123083646 TGCTGCATTTCCAGTTCATC Chr3:123083605..123083624 59.81 45
downstream ENSMUSE00000176364 Chr3:123083138..123083225 No primer for this exon
downstream ENSMUSE00000176347 Chr3:123079063..123079153 TGGGAGGAGTGTTTGACTTAGC Chr3:123079042..123079063 60.66 50
downstream ENSMUSE00000176346 Chr3:123077663..123077804 TTTCTCATTCGCAGTGATGC Chr3:123077659..123077678 59.96 45
downstream ENSMUSE00000176358 Chr3:123076888..123076980 TGCTGCAATCTCATCGATTT Chr3:123076926..123076945 59.38 40
downstream ENSMUSE00000176354 Chr3:123075475..123075591 CTCTGGAAAACTGCCTTTGG Chr3:123075460..123075479 59.85 50
downstream ENSMUSE00000176350 Chr3:123074193..123074403 CATGAATGAAGTCCCCGTCT Chr3:123074318..123074337 59.93 50
downstream ENSMUSE00000506094 Chr3:123071217..123072608 AGTATGAGTTGGGGGCACTG Chr3:123072500..123072519 59.99 55
downstream ENSMUSE00000563664 Chr3:123067864..123068061 TCCCTCTGAGGTCACATTCC Chr3:123067869..123067888 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr3:123088608..123088628 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCCTAGCTCAGCAGGTGTG Chr3:123088673..123088694 62.59 61.9 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028114