Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27046
Trapped Gene
Mcam (ENSMUSG00000032135)
Vector Insertion
Chr 9: 43942840 - 43944600
Public Clones (sanger)
Private Clones OST76802 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361170 (Chr9:43942754..43942839 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTGTGCGTCTTCTTGTTC Chr9:43942789..43942808 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361170 (Chr9:43942754..43942839 +)
Downstram Exon
ENSMUSE00000216926 (Chr9:43944601..43944731 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTGTGCGTCTTCTTGTTC Chr9:43942789..43942808 59.88 50 CTTTTCCTCTCCTGGCACAC Chr9:43944623..43944642 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361170 Chr9:43942754..43942839 TGGTGTGCGTCTTCTTGTTC Chr9:43942789..43942808 59.88 50

*** Putative Vector Insertion (Chr 9: 43942840 - 43944600) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216926 Chr9:43944601..43944731 CTTTTCCTCTCCTGGCACAC Chr9:43944623..43944642 59.84 55
downstream ENSMUSE00000354583 Chr9:43944821..43945028 AAGGCGGTGCTCATATTCAC Chr9:43944907..43944926 60.1 50
downstream ENSMUSE00000426016 Chr9:43945122..43945192 CCACGACATTGGCTTGAATA Chr9:43945163..43945182 59.54 45
downstream ENSMUSE00000216928 Chr9:43945301..43945388 GAATGGGGTAGCCGTTTCTC Chr9:43945340..43945359 60.83 55
downstream ENSMUSE00000216912 Chr9:43946918..43947097 AGCCACTGGACTCGACAATC Chr9:43946962..43946981 60.27 55
downstream ENSMUSE00000216905 Chr9:43947241..43947362 TCACATGATCCCCTTCCTTC Chr9:43947309..43947328 59.86 50
downstream ENSMUSE00000216908 Chr9:43947483..43947645 TTCATCGGTGCTCTCCTCTT Chr9:43947527..43947546 59.95 50
downstream ENSMUSE00000216920 Chr9:43947736..43947854 TTACTTTCTGCCTCGCAGGT Chr9:43947823..43947842 60.01 50
downstream ENSMUSE00000216899 Chr9:43947943..43948084 GGTACGATTCAAGCCAGGAA Chr9:43948062..43948081 60.07 50
downstream ENSMUSE00000216897 Chr9:43948220..43948341 TCCTGAAGCCTCACAAGACA Chr9:43948305..43948324 59.54 50
downstream ENSMUSE00000216922 Chr9:43948445..43948586 GCACCTGTCTCCAGAAGCTC Chr9:43948530..43948549 60.14 60
downstream ENSMUSE00000216919 Chr9:43948681..43948776 GGTTTGGCTGGAGTCAGGTA Chr9:43948721..43948740 60.11 55
downstream ENSMUSE00000508859 Chr9:43948928..43949075 GCAGCTTGCCCTTCTTGTAG Chr9:43949050..43949069 60.15 55
downstream ENSMUSE00000536032 Chr9:43949358..43949475 GTCTCCTGGAGCCCTCTTGT Chr9:43949475..43949494 60.79 60
downstream ENSMUSE00000536031 Chr9:43949867..43950803 CACAAGGACCAATGTGAACG Chr9:43950296..43950315 60 50
downstream ENSMUSE00000637506 Chr9:43949867..43950803 CACAAGGACCAATGTGAACG Chr9:43950296..43950315 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAATCGCCTTGCAGCAC Chr9:43942888..43942908 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032135