Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27053
Trapped Gene
Rpl23a (ENSMUSG00000058546)
Vector Insertion
Chr 11: 77996489 - 77997020
Public Clones P148E06 (ggtc) IST13630H2 (tigm) IST13630H2 (tigm) IST14442B3 (tigm)
IST14442B3 (tigm) IST14742A1 (tigm)
Private Clones OST76192 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661713 (Chr11:77997021..77997059 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661713 (Chr11:77997021..77997059 -)
Downstram Exon
ENSMUSE00000661712 (Chr11:77996305..77996488 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTTTCAGCACCGCCTTCTTA Chr11:77996401..77996420 60.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661713 Chr11:77997021..77997059 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77996489 - 77997020) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661712 Chr11:77996305..77996488 CTTTCAGCACCGCCTTCTTA Chr11:77996401..77996420 60.51 50
downstream ENSMUSE00000487902 Chr11:77994919..77995095 GCTTATTGGCCTTGACATCC Chr11:77994964..77994983 59.53 50
downstream ENSMUSE00000661711 Chr11:77994656..77994725 CAAGCGAACATACGCCTTCT Chr11:77994670..77994689 60.41 50
downstream ENSMUSE00000661710 Chr11:77994442..77994499 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGCGGTATGGGAATCTGT Chr11:77996995..77997015 59.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGCGGTATGGGAATCTGT Chr11:77996995..77997015 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCATCCTTTTCAGCCAAGAT Chr11:77997042..77997062 59.13 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCATCCTTTTCAGCCAAGAT Chr11:77997042..77997062 59.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058546