Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27056
Trapped Gene
Ptpmt1 (ENSMUSG00000063235)
Vector Insertion
Chr 2: 90754333 - 90757585
Public Clones IST12364B7 (tigm) IST12364B7 (tigm) IST15002E2 (tigm)
Private Clones OST75541 (lexicon)
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306013 (Chr2:90757586..90757666 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTACGAGACCCGATTCCTG Chr2:90757601..90757620 59.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306013 (Chr2:90757586..90757666 -)
Downstram Exon
ENSMUSE00000167824 (Chr2:90754141..90754332 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTACGAGACCCGATTCCTG Chr2:90757601..90757620 59.16 55 TCTGGATCGACCAGCCTTAC Chr2:90754152..90754171 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395492 Chr2:90757868..90758143 TCTACCCGACGCTGCTCTAC Chr2:90757874..90757893 60.56 60
upstream ENSMUSE00000345847 Chr2:90757767..90757865 ACTGGTACCACCGCATCGAC Chr2:90757815..90757834 63.29 60
upstream ENSMUSE00000687929 Chr2:90757767..90758298 ACAGTTTCACCCGATCTTGC Chr2:90758203..90758222 60.12 50
upstream ENSMUSE00000306013 Chr2:90757586..90757666 AGTACGAGACCCGATTCCTG Chr2:90757601..90757620 59.16 55
upstream ENSMUSE00000687927 Chr2:90757586..90757666 AGTACGAGACCCGATTCCTG Chr2:90757601..90757620 59.16 55

*** Putative Vector Insertion (Chr 2: 90754333 - 90757585) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000167824 Chr2:90754141..90754332 TCTGGATCGACCAGCCTTAC Chr2:90754152..90754171 60.22 55
downstream ENSMUSE00000687925 Chr2:90754141..90754332 TCTGGATCGACCAGCCTTAC Chr2:90754152..90754171 60.22 55
downstream ENSMUSE00000643483 Chr2:90751153..90751476 GGAGATGTGTGACCGGATTT Chr2:90751392..90751411 59.79 50
downstream ENSMUSE00000687923 Chr2:90751153..90751476 GGAGATGTGTGACCGGATTT Chr2:90751392..90751411 59.79 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTACGAGACCCGATTCCTGT Chr2:90754598..90754618 59.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGCACGTGACTGGGAAAAC Chr2:90754519..90754540 62.93 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGTACTGGACGAGAACGTG Chr2:90754644..90754664 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGTCGTGACTGGGAAAACC Chr2:90754600..90754620 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063235